5 лет на форуме Автор 3 уровня Топ тема Все
Награды
5 лет на форуме
5 лет на форуме
Автор 3 уровня
Автор 3 уровня
Топ тема
Топ тема
1000 просмотров
1000 просмотров
Получил результат генетического тестирования, я 100% саха! хотя сомнений в этом не было :)))
  2864
Цитата:
Отчет по интерпретации полученных результатов тестирования
генетического образца в лаборатории FTDNA


1. Уважаемый участник программы, примите поздравления с получением первых результатов тестирования результатов Вашего генетического образца! Эти результаты приоткрывают историю Вашего рода по мужской линии.
Y-хромосома передается только по мужской линии, от отца у сыну. У женщин Y-хромосомы нет. Эта хромосома у человека представляет из себя двойную спираль, состоящую из 59 млн. пар нуклеотидных оснований. Нуклеотидные основания бывают четырех видов – аденин (А), тимин (Т), цитозин (С) и гуанин (G).
2. Что является предметом изучения? Зарегистрированные генетические мутации. Их разнообразие сводится к двум классам:
1) Тандемные мутации в Y-STR локусах. Y-STR локусы – это особые участки в хромосоме, где содержатся тандемные повторы нуклеотидов.
Пример: локус DYS392.
Локус располагается в конце приведенной последовательности нуклеотидов и выделен жирным шрифтом:
TAGAGGCAGTCATCGCAGTGGCCCAAGTGATCTTGCAACATCTCCATCCATGTTGCTCCAAAGG
ACCCAATTTTACTGTAAATGGTTGTATAGTATTTTATGGTCTACATAGACCATATTTACCATAT
GTTCATCCATATTTTCTTCATTAATCTAGCTTTTAAAAACAACTAATTTGATTTCAAGTGTTTG
TTATTTAAAAGCCAAGAAGGAAAACAAATTTTTTTCTTGTATCACCATTTATT/TAT/TAT/TA
T/TAT/TAT/TAT/TAT/TAT/TAT/TAT/TAT/TAT/TTACTAAGGAATGGGATTGGTAGGTC
Внутри фрагмента длиной 307 пар нуклеотидных оснований видим 12 тандемных повторов TAT. В приведенном примере локусу DYS392 присваивается значение 12.
    Тандемы могут состоять от двух до шести нуклеотидов.
В настоящее время Y-STR локусы – наиболее изученные объекты, так как они достаточно легко измеряются.
2) Однонуклеотидные мутации, они же – Y-SNP полиморфизм. Это обычные мутации в последовательности нуклеотидов. Различаются три основных вида мутаций:
- замена (субституция) одного вида нуклеотидов другим;
- делеция, т.е. выпадение нуклеотида из цепочки;
- инсерция, т.е. вставка дополнительного нуклеотида в цепочку.    
Замены, делеции, инсерции могут происходить также с двумя, тремя и более соседними нуклеотидами одновременно. Измерение SNP мутаций – более сложная задача. Сейчас, с появлением машин-секвенаторов нового поколения (с конца 2012 года), стало возможным считывать практически все пригодные для целей ДНК-генеалогии участки Y-хромосомы.
Следует сказать, что показатели Y-STR и Y-SNP четко связаны друг с другом. Маркеры Y-SNP (их еще называют снипы) определяют так называемые гаплогруппы Y-хромосомы.
3. Из Вашего образца пока изучены только 12 Y-STR локусов. Они обозначаются: DYS393, DYS390, DYS19, DYS391, DYS385a, DYS385b, DYS426, DYS388, DYS439, DYS389I, DYS392, DYS389II.
Но уже этих данных достаточно, чтобы уверенно отнести Вашу Y-хромосому к одной из уже известных гаплогрупп. Ваши показатели в уже приведенном выше порядке следования:
14-23-14-11-11-13-11-12-10-14-16-32.
Такая совокупность тандемных повторов свойственна для образцов гаплогруппы N1c1, характеризующейся Y-SNP мутацией М178. Это не все. Ваш гаплотип располагается на отдельной ветви внутри гаплогруппы N1c1, состоящей практически из одних саха-якутов. Это видно по следующим приметам: в DYS392 шестнадцать тандемных повторов, а в DYS389II – тридцать два повтора. В среде ДНК-генеалогов эта ветвь называется якутской ветвью N1c1.
Якутская ветвь хорошо изучена популяционными генетиками. Они выяснили, что 90 % мужчин саха имеют такую Y-хромосому. Ныне это около 200 тысяч человек. Ученые обнаружили, что все эти мужчины – потомки одного человека (эффект основателя).
4. Мутации в Y-STR локусах происходят относительно часто – в среднем одна мутация на 500 поколений в одном локусе. Поэтому показатели Y-STR повторов у разных мужчин внутри якутской ветви слегка различаются. Это успели накопиться мутации. Для примера привожу свой собственный гаплотип:
13-23-14-11-11-13-11-12-10-14-16-32.
Все повторы в локусах совпадают, кроме первого – DYS393. Такие различия позволяют ДНК-генеалогам устанавливать степень родства между обладателями разных гаплотипов. Классификацию генеалогических линий внутри якутской ветви N1c1 я предложил в конце 2010 года. См. приложенную статью. По этой классификации мы с Вами находимся в одной и той же большой подветви, условно называемой «родом Эллэя». Она маркируется характерными значениями тандемных повторов DYS392 = 16 и DYS389II-DYS38о9I = 18. Этот род охватывает около половины всех мужчин саха.
5. Что дальше? Для уточнения степени родства с другими известными гаплотипами нужны дополнительные измерения. До февраля 2014 года ждем результатов углубленного изучения моего собственного образца на наличие SNP мутаций, характеризующих якутскую ветвь гаплогруппы N1c1. По моим расчетам, этих снипов должно быть 10-15 штук. Далее будем определяться, какие снипы у Вас тестировать.

С уважением, Дмитрий Адамов,

17 ноября 2013 года.


Больше спасибо Дмитрию Адамову за тестирование и интерпретацию результатов!
Ответов 278 Написать ответ
  • Чемезов
    23 декабря 2013  

    Вред собачий

    Может ты вылитый викинг?

    0
  • Starkoff
    23 декабря 2013  

    О! Поздравляю! :)


    Блин, когда же я соберусь... Тоже любопытно. :)

    0
  • Starkoff
    23 декабря 2013  

    "Ученые обнаружили, что все эти мужчины – потомки одного человека"


    Та самая ветка с возрастом общего предка примерно в 1000 лет. ПО ней, обычно, судят о приходе "общего предка" на среднюю Лену.

    0
  • Никон2
    23 декабря 2013  

    Автору

    И сколько стоит данный вид услуг?

    0
    • tifedorov
      tifedorov
      Тимур Федоров
      23 декабря 2013  

      не знаю

      мне, волею судеб, достался бесплатный набор.

      0
    • Starkoff
      23 декабря 2013  

      От 12-ти до 17-ти маркеров - около 3 тысяч наших деревянных рупий. :)


      А я для своего любопытства планочку закладывал всё выше - 12, 17, 37, 67, 111, а теперь и полный геном подоспел.
      Зачем это мне - не знаю, просто любопытно. :)
      Но смотрю по деньгам, чтобы любопытство не стало накладным. Сегодня мой компромисс - 120 уе за 37 маркеров в http://www.familytreedna.com/ , хотя можно и 67, он тоже по цене недалеко ушёл...

      0
      • Никон2
        23 декабря 2013  

        Для меня - астрономическая сумма

        Если уе 30 с лихуем

        0
        • Starkoff
          23 декабря 2013  

          Ты словно не в Якутии живёшь. :)


          Я в своё время отметил радикальную разницу покупательной способности населения Якутска по сравнению с моим родным Иркутском - раза в три как минимум. Средний достаток в Якутске был значительно выше. :)

          Если тебе надо до ста уе, то, может, путь tifedorov'а ещё не закрыт? Спроси его? А он первоисточник спросит. Там какая-то программа у него...

          0
  • tifedorov
    tifedorov
    Тимур Федоров
    23 декабря 2013  

    в базе данных familytreedna.com

    среди моих 12-маркерных совпаденцев - Yakov Maksimov, Mr. Rodion Kulichkin, Mr. Andrey Lebyodkin, Dmitri Semenovich Adamov Ph.D. Как полагаю, все саха :)

    0
    • скоро
      23 декабря 2013  

      ничего киргизы добавят

      0
    • Starkoff
      23 декабря 2013  

      12 маркеров - маловато будет. Запросто и белокурые варяги-Рюрики в родственниках окажутся. :)


      Потом пойди-докажи, что твой первопредок Эллей не на струге по Лене приплыл с гоп-компашкой викингов. :)
      Твой анализ возможно ли расширить до 37 маркеров? Я читаю на форумах, что он предпочтительней для детализации.

      0
      • tifedorov
        tifedorov
        Тимур Федоров
        23 декабря 2013  

        конечно возможно.

        как понимаю, анализ делали именно на те 12 локусов, которые специфичны для разных народов. и поэтому среди совпаденцев у меня именно саха, а не финны с татарами. особого смысла расширять маркеры для себя не вижу, т.к. якутский N1c1 достаточно изучен, и расширенный гаплотип тоже думаю закажут и изучат. Если бы у меня была бы какая-то нетипичная для якутов гаплогруппа, тогда можно было и расширить, чтоб узнать что к чему.

        0
        • кулумнуур
          23 декабря 2013  

          куда нужно обращаться

          тоже хочу

          0
          • tifedorov
            tifedorov
            Тимур Федоров
            23 декабря 2013  

            я на forum.molgen.org

            случайно наткнулся на предложение Nimissin'a бесплатно сдать тест.

            Цитата:
            Объявление. Есть 3 готовых набора для определения значений первых 12 Y-STR локусов в FTDNA (Family Tree DNA).
            Я заинтересован продолжить изучение якутского кластера гаплотипов N1c1-L839(xL1026). Поэтому готов предоставить эти наборы бесплатно. Требования к кандидатурам:
            1) происхождение из народа саха по мужской линии;
            2) знание родословной по мужской линии не менее 5 поколений.

            Коммуникации. Зарегистрироваться на форуме Молгена (http://forum.molgen.org/). Направить личное сообщение внутри форума пользователю nimissin.

            http://forum.molgen.org/index.php/topic,267.120.html
            Насколько знаю, 2 набора использовано, третий не знаю

            0
  • 1
    23 декабря 2013  

    странно, как

    это в Усть_Алдане оказались носители N, начали появляться сомнения в выводах генетиков.
    На мой взгляд гены палеоазиатов N, должны преобладать у хангаласцев, жителей левого берега Лены и естественно Вилюйчан, имеющих в основном левобережное происхождение.
    А вот хори-монгольское С, как раз должно преобладать в Илин Энэр, Заречье.
    Олонхо должно было получить научное подтверждение.
    Ещё вопрос, если половина мужчин саха палеоазиаты с N1C1, то вторая половина кто?
    Всё таки Никон прав? Есть плюсы и есть минусы?

    0
    • tifedorov
      tifedorov
      Тимур Федоров
      23 декабря 2013  

      нет, половина мужчин - это условно "род Эллея"

      Цитата:
      Классификацию генеалогических линий внутри якутской ветви N1c1 я предложил в конце 2010 года. См. приложенную статью. По этой классификации мы с Вами находимся в одной и той же большой подветви, условно называемой «родом Эллэя». Она маркируется характерными значениями тандемных повторов DYS392 = 16 и DYS389II-DYS38о9I = 18. Этот род охватывает около половины всех мужчин саха

      Остальные тоже n1c1, просто немножко другие линии.
      И кстати, палеоазиаты ваще не причем, ибо среди палеоазиатских и финно-угорских гаплотипов N1c1 нет похожих на гаплотипы якутского кластера. Если найдут - другой разговор

      0
      • 1
        23 декабря 2013  

        почему нет?

        как раз родство якутов по N с северными самоедами научный факт. Расхождение произошло предположительно от 500 до 800 лет.
        И обе верссии имеют право нажизнь.
        Если 500 то значит раскол произошел с началом продвижения казаков-московитов на Сибирь. Часть самодийцев казаки вели с собой вкачестве вожжей и помогаек.
        Если расматривать 800 лет, то возможно самодийские племена начали вытесняться с Енисейкой лесостепи и притаёжья разросшимися бурят-монгольскими племенами. Часть ушла в Зап. Сбирь, а предки якутов через водную систему рек Тунгусок попали на территорию Якутии.
        Про самодийство якутов еще в догенетические времена, это теории Сомогото пришедшего к этому по наитию. Натолкунуло его к этому легкий переход на другие языки якутов, вспомнили про "кормящий язык"?

        0
        • tifedorov
          tifedorov
          Тимур Федоров
          23 декабря 2013  

          окей-окей, я знаю, что ты ярый сомоготец :)

          с самодийцами там родство на уровне нескольких тысячелетий, если не больше. ближайшие родственники по N1c - тюрки Южной Сибири и Алтая

          0
          • 1
            23 декабря 2013  

            малые тюрки Алтая и Южной Сибири

            с этим никто не спорит.
            Даже басни олонхо не надо придумывать, в истории описан процесс этногенеза хакасов, за какие меньше 100 лет разные койбалы, кето перешли на тюркоязычие и стали малочисленными тюрками Сибири.
            И конечно они тоже имеют преобладающую N, являясь очень близкой генетической роднёй саха, с разницей в несколько сот лет.

            0
            • tifedorov
              tifedorov
              Тимур Федоров
              24 декабря 2013  

              у самодийцев Южной Сибири

              гаплогруппа Q, если не знали. Они настоящие палеоазиаты, со времен ухода индейцев живут в Сибири. N1c - гаплогруппа кочевников. Ее наличие во всех тюрко-монгольских этносах (вплоть до анатолийских турков) не объяснишь одним финно-угорским или самодийским (вы уже определитесь!) влиянием.

              0
              • 1
                24 декабря 2013  

                у якутов в деревнях много негритят бегают

                так что анатолийские турки мимо.

                0
                • tifedorov
                  tifedorov
                  Тимур Федоров
                  26 декабря 2013  

                  негритенка в зеркало смотри.

                  а я тебя про истинно палеоазиатов говорю - гаплогруппа Q. возразить нечего так молчи в тряпочку

                  0
                  • 1
                    26 декабря 2013  

                    я разве спорю?

                    да КУ присутсвует но не превалирует, также как у части якутов есть негритятские гены, но это ничего не значит.
                    Вот освежи память, примитивно для таких как ты.
                    image
                    В состав палеоазиатов раньше включали даже нивхов и айнов.
                    На схеме видим, что КУ сконцентрирован у кедов (у Быйанга наверное зашкаливает) и в районе Ессейских Якутов и Якутских долган.
                    Это не басни-олонхо с этим не поспоришь.

                    0
                    • 1
                      26 декабря 2013  

                      здесь же видим

                      благородная арийская РЯ (R) до якутов не дошла.
                      А наличие Ры у современного якута это след длиннорублевщиков и каторжан.

                      0
  • Суулла Уола
    23 декабря 2013  

    Эҕэрдэлиибин

    Тоже хотелось-бы пройти тест. Денег лишних не предвидится :-)

    0
    • tifedorov
      tifedorov
      Тимур Федоров
      23 декабря 2013  

      махтал :)

      0
      • Крио
        23 декабря 2013  

        Уважаемый tifedorov!

        А что тебе дало это тестирование? Прям как будто прошёл измерение ушей и черепа на предмет нордическости (без обид). Неужто не был уверен, что являешься саха?
        Имхо, я бы эти деньги погорельцам-саха пожертвовал.

        0
        • Starkoff
          24 декабря 2013  

          Крио, мне тоже интересно взглянуть на свой род со стороны генетики, чесслово. :)


          Я всецело поддерживаю tifedorov'а в его интересе. :)

          0
        • tifedorov
          tifedorov
          Тимур Федоров
          24 декабря 2013  

          во-первых, тест сдал бесплатно

          т.к. набор предоставил наш земляк энтузиаст-генограф Дмитрий Адамов, который заинтересован в изучении генетики своего родного народа. И в какой-то мере, можно сказать, я вызвался из патриотических соображений. Толпы желающих у него не наблюдалось.
          Во-вторых, в наше время если интересуешься этнографией, то неизменно заинтересуешься и этногенетикой. Поэтому для меня было принципиальным узнать и свою гаплогруппу.

          0
          • Крио
            24 декабря 2013  

            Энтузиаст?

            А на гос. республиканском уровне что-нито деется?

            0
            • Starkoff
              24 декабря 2013  

              Я думаю, нет. У них интересы другие - брюхо набить да порядочную мину соблюсти. :)


              Хотя на республиканские деньги можно было глобальный проект забабахать - 100 населения обеспечить погным геномом да ещё и приплачивать, привлекая нежелающих. :)
              А потом составить глобальную карту нации и от неё плясать в поисках самоидентичности...

              0
  • Анка_пулеметчица
    24 декабря 2013  

    а женщин проверяют?

    0
    • dionisiy
      dionisiy
      Dio Nisiy
      24 декабря 2013  

      проверяют что? настоящесть, породу?

      0
    • tifedorov
      tifedorov
      Тимур Федоров
      24 декабря 2013  

      на Y-хромосому нет, за ее отсутствием у женщин

      можно сделать анализ митохондриальной ДНК

      0
      • Анка_пулеметчица
        24 декабря 2013  

        и что показывает данный анализ?

        принадлежность нации?

        0
        • dionisiy
          dionisiy
          Dio Nisiy
          24 декабря 2013  

          нет конечно, он показывает кто общий пра-пра.. отец

          а отец на физику потомства не влияет и думаю именно физический облик, устройство имеет смысл причислять к нации


          но генетики следуют древнему мифу доминирования мужчины над женщиной поэтому нации они также по "мужским генам" смотрят )

          у женщин тоже есть своя "линия генной преемственности", тоже можно узнать кто и когда был у женщины общей бабушкой, когда она жила, только детализация не такая как у мужчин, там довольно обобщенные результаты на данный момент получаются.

          0
          • Никон2
            24 декабря 2013  

            Данная точка отсчета смотреть нацию по Отцу правильна.

            Баба - это катализаторша только.
            А вот порода = раса идет от матери, увы.

            0
        • Starkoff
          24 декабря 2013  

          мтДНК менее информативный, поскольку меньше и не столь изменчив.


          Все споры ведём лишь по мужскому Y-отростку. :)
          Однако чуть позже, когда распространится анализ на полный геном, женщины будут наравне с мужиками - есть в полном геноме женщины (и мужчины) дубль Y-последовательностей. Поэтому пободаемся ещё. :))

          Мужик - это поле экспериментов. Его уже устаканившиеся мутации передаются глубже в общие части геномов женщины и мужчины.

          0
          • dionisiy
            dionisiy
            Dio Nisiy
            24 декабря 2013  

            у женщин копия есть? не слышал

            0
            • Никон2
              24 декабря 2013  

              Про баб даж и не думай

              У нас все по Отцу.
              Отче род от господне.

              0
            • Starkoff
              24 декабря 2013  

              Когда читал про полный геном, встречал упоминания.


              Разумеется, сам ничего не знаю. :)
              Читал, что есть что-то дублирующее участки Y-хромосом. А в одном разговоре на забанившем меня родстве ребята мне говорили про аналог гаплогрупп в той части. Это, в принципе, нормально - где-то же должны мутации закрепляться. Мужчин мутирует и передаёт уже мутировавшие области по наследству, мужскому и женскому.

              Я думаю, Y-хромосома специально легкодоступна для мутаций. Через неё вид приспосабливается к внешним условиям. Думаю, женский мир сам по себе почти не мутирует, а значит и не развивается. :)

              0
              • Никон2
                24 декабря 2013  

                Да.

                Всяк мктации от Бога чрез мужика.
                Без разрешения бога мутаций быть не может.
                А баба не мутирует.
                Вход в творении = Ай ей воспрещен из-за налияия Дьяволого в ней.
                Так что Бог только чрез мужика.
                Это одна из основных сторон грани плюсомасти на земле.

                0
                • Анка_пулеметчица
                  24 декабря 2013  

                  ой да лаадно вам винить во всем женщин :(

                  сами безвольные, придумали дьявола

                  кстати и в муччине и в женщине сидят бес и ангел. Незря есть пословица про мужикофф "седина в бороду-бес в ребро"

                  0
                  • Starkoff
                    24 декабря 2013  

                    Есть другой вариант - человек в своих воплощениях переживает обе жизни - и женщин и мужчин. :)


                    Никон сегодня мужик, а потом женщиной будет. :)

                    0
                    • Анка_пулеметчица
                      24 декабря 2013  

                      ахахааа))) бедный Никон :(((

                      ему это известие может не понравица ...и скока раз человек может перевоплощаца ?

                      0
                    • Никон2
                      24 декабря 2013  

                      Реинкарнация кармайская, увы, на нас не распространяется.

                      Это для детей тьмы Дьяволого пассаж

                      0
                      • кылбар
                        24 декабря 2013  

                        А также для

                        душ баб, как земных существ. КУТ же саха-мужика уходит к Создателю, т.к. он ЕГО частичка. Душа же у бабы - химический глюк КУТ под названием солевой обмен. Поэтому говорят - курица не птица, женщина не человек:) Без обид. Это не мои слова, а народная мудрость.

                        0
  • Кылбар
    25 декабря 2013  

    А ты, старче

    испорченный:) Надеюсь что это твое подсознательное переживание, а не реальные мечтания:) Хотя ментал у тебя хоровитский, дух то остается отче-мужиковым. Русские - отче сторона, всегда, но отвлекаются часто на хоринские вещи:) Неустойчивые.

    0
  • ))
    25 декабря 2013  

    учитывая, что отличия генов человека и шимпанзе всего 1%,

    все эти генетические тесты современных людей вызывают снисходительную улыбку.

    Цитата:

    Фактически, среднестатистический человеческий белок за эволюцию людей накопил только одно уникальное отличие от шимпанзе, с того момента, как люди и шимпанзе откололись от общего предка — приблизительно 6 миллионов лет назад

    0
    • tifedorov
      tifedorov
      Тимур Федоров
      26 декабря 2013  

      снисходительно в зеркало смотрись и улыбайся

      0
      • хм
        26 декабря 2013  

        ты с усть-алданского улуса?

        или с амгинского?


        кстати, все генетические заключения о народе саха делаются почему-то на основе усть-алданских выборок. Видимо, из-за близости с Якутском, не надо далеко ездить.

        0
        • tifedorov
          tifedorov
          Тимур Федоров
          26 декабря 2013  

          мэнэ ханаласпын

          0
        • tifedorov
          tifedorov
          Тимур Федоров
          26 декабря 2013  

          это устаревшие данные

          выборки давно расширены, со всей Якутии образцы, но результат один. 9 из 10 якутов по мужской линии потомки одного человека или рода. Так что Никон с Кылбаром в какой-то мере правы со своим мужским началом Саха

          0
          • Starkoff
            26 декабря 2013  

            Подтверждаю. Исследователи публикуют свои выборки. Они (выборки), как бы, нормальные.


            Со всей территории, с описанием родни до какого-то колена. Так было с каким-то исследованием, кажется, 2004 года. Здесь, на форуме, народец переживал за выборки, а потом нашли описание, успокоились... :)

            0
            • студентСаха
              7 января 2014  

              тебе с Масквы виднее что ли. хитрожопый иркутянин Старков

              Тебе то откуда знатть
              Ты ж иркутянин
              Всего два года пожил в якутии да и то в якутске
              И то если поверить тебе


              А ща вообще в москве живешь
              У кого работашь?
              Хитрожоп, сук

              0
              • Starkoff_
                7 января 2014  

                Иди учись, студент. :)


                Принимаю комментарии лишь по существу. :)
                Сказано - "публикуют выборки". Если докажешь отсутствие публикаций - поспорим. Иначе - go to school. :)

                0
    • СуоК
      26 декабря 2013  

      \ учитывая, что отличия генов человека и шимпанзе всего 1%, - ))\

      Шинпанзеподобный - это адъарай, ему наш Манчаары ненравиться.

      0
      • Starkoff
        26 декабря 2013  

        Над героизацией Манчаары многие в якутии потешались.


        И это нормально, поскольку восприятие его - весьма оценочное.
        Я был бы склонен согласиться с критиками, но меня останавливает лишь факт творчества Манчаары - поэт, певец и прочее... Начить, не всё так просто. А,значит, не мне судить. :)

        Если бы ему не приписывали творческого начала, то и для меня он был бы простым бандюганом, попавшим в струю. :)
        Я точно так же не верю сказкам про "добрых" Дубровского, Робина Гуда и прочих аналогичных.

        0
        • кулумнуур
          10 февраля 2014  

          Манчаары это человек который пошел против системы

          системы чиновничьего произвола. Богачи подкупили судей, а те развратили все, мол Манчаары крутился возле замужней женщиной, после этого ему раздали розги из-за этого человек сильно обиделся на всю систему подкупных чиновников и на богачей.
          и начал мстить всем без оглядки, будь он виновен или не виновен.
          и он стал врагом государства.

          вон в америке был такой случай, нефтяники хотели выкупить землю у одного человека, он отказался, все соседи продали свои участки и переехали, а он остался в результате его обрезали от света, воды, нарушая его конституционные права. начали штрафовать и.т.д.
          полиция вместо того чтобы защищать его, встал на защиту нефтяников
          в итоге вывели человека и он стал врагом государства, купил бульдозер на остатки средств, сварил на него защиту, вооружился автоматом. и пошел таранить полицейский участок, местную мэрию.

          а это аналог с Манчаары.

          0
    • dionisiy
      dionisiy
      Dio Nisiy
      26 декабря 2013  

      а от мыши когда? ведь от мыши мы отличаемся на 10%, а от риса или пшеницы?

      1% в генах это огромная цифра если что

      что думать о людях, которые кроме обезьян ничего думать не хотят, словно обезьяна это ось мира, эталон от которого надо мерить себя

      0
  • 1
    26 декабря 2013  

    почему якуты открещиваются от палеоазиатства?

    image
    Видим, что Q и N, есть у турков соответсвенно 2 и 4%.
    Значит и турки маленько палеоазиаты.
    А ты федоров смешон считая Q чисто палеоазиатскай геном.

    0
    • nathan
      nathan
      Ветеран
      26 декабря 2013  

      Где?

      image

      0
    • nathan
      nathan
      Ветеран
      26 декабря 2013  

      Где палеоазиаты?

      0
      • 1
        26 декабря 2013  

        во народ, вы что совсем не читаете

        вообщето заметно бывает, впечатление, что сами с собой спорят.

        Цитата:
        негритенка в зеркало смотри. - tifedorov
        26.12.2013 (00:10) (188.244.188.1)
        а я тебя про истинно палеоазиатов говорю - гаплогруппа Q. возразить нечего так молчи в тряпочку

        0
        • nathan
          nathan
          Ветеран
          26 декабря 2013  

          Где у якутов Ку

          0
          • Starkoff
            26 декабря 2013  

            Он тебе показал наличие Q и N1c у далёких Турков, как пример.


            Типа, обе гаплоруппы - палеоазиатские... :)
            А я бы по-другому показал палеоазиатскость - через мощнейший женсукий палеоазиатский пласт, женскую макросемью D. Здесь уже никуда не отвертисся, реально палеоазиатский субстрат, единый по всей Азии...

            0
      • 1
        26 декабря 2013  

        читай по английски

        North Asian гаплогруппа, включает Q и N, это и называется условно палеоазиатская. Почему якуты в бешенсвто впадают от своего неблагородного происхождения, давно нужно смирится с этим и жить дальше.
        Native European это и есть истинно европейская это белые хоровиты, это типы разные R.
        Near - Eastern, а это разные кучеряво-смуглые хоровиты.

        0
        • nathan
          nathan
          Ветеран
          26 декабря 2013  

          неблагородного происхождения)))

          В чем неблагородство?

          0
          • 1
            26 декабря 2013  

            не притворяйся, АААА

            почему то все якуты ищут в своих корнях хоть капельку, R.
            Комплексы?
            А лучше было бы для якутов возродить свой утерянный язык, отказавшись от навязанного тюркоязычия.

            0
            • nathan
              nathan
              Ветеран
              26 декабря 2013  

              Кто ищет?

              Зачем искать,то чего нет.

              0
            • Starkoff
              26 декабря 2013  

              Это какой язык? Что было - не вернуть... Сегодня Саха - тюрки...


              Вопрос лишь в приоритете принадлежности - Саха есть первые тюрки или Саха тюркизированы. Но это, таки, второй вопрос. Первое - утверждение, что сегодня Саха=Тюрки... :))

              Я так вижу это со стороны. Если у тебя иной взгляд - поделись, пожалуйста? :)
              Какой язык ты имеешь в виду?

              0
          • 1
            26 декабря 2013  

            из Комузы

            Цитата:
            Ученые СВФУ установили, что в генофонде народа саха есть древний европейский компонент

            Автор: Монархист (94.245.173.10) 24.12.2013 (22:11) Выделить тему :: :: [Пожаловаться]


            Цитата:
            Заведующая научно-исследовательской лабораторией молекулярной биологии Института естественных наук СВФУ Светлана Федорова огласила результаты изучения генетической истории населения Северо-Восточной Евразии. Сегодня состоялось открытие научно–исследовательской лаборатории молекулярной биологии Института естественных наук СВФУ.
            «Исследования в данной сфере были начаты 10 лет назад с целью изучения происхождения народа саха и других народов, проживающих на территории Якутии. Мы собрали пробы ДНК разных национальностей населения республики общей численностью 700 человек. Примечательно, что геном был проанализирован на базе Эстонского биоцентра. По результатам анализов установлено, что Якутия является продолжением Южной Сибири и входит в общий генетический континуум, объединяющий Южную Сибирь, Монголию, Северный Китай и Якутию. Кроме того, выявлено двойственное происхождение европейских линий в генофонде народов Якутии. Установлено, что в генофонде народа саха есть очень древний европейский компонент, связанный с кочевыми народами, которые обитали в степной зоне Евразии», – подчеркнула заведующая лабораторией Светлана Федорова.
            Отметим, что научно-исследовательская лаборатория молекулярной биологии Института естественных наук СВФУ в дальнейшем планирует изучать генетические связи народов Якутии уже с использованием анализов костных останков древних погребений.

            0
          • nathan
            nathan
            Ветеран
            26 декабря 2013  

            N

            Y-хромосома гаплогруппы N-M231 (Hg N) широко распространены в Восточной и Центральной Азии, Сибири, а также в Восточной и Северной Европе. Предыдущие исследования показали, против часовой стрелки доисторических переноса Hg N из Восточной Азии, Восточной и Северной Европы. Однако, корень этой Y-хромосомы, lineage и его подробная шаблона распределения в странах Восточной Азии по-прежнему остаются неясными. Мы проанализировали гаплогруппе профили и филогеографических структуры 1,570 Hg N особей из 20,826 мужчин в 359 групп населения на территории Евразии. Сначала мы генотипированы 6,371 мужчин из 169 населения в Китае и Камбодже, и данных, созданных в 360 Hg N особей, а затем в сочетании опубликованные данные по 1,210 Hg N особей из Японии, юго-Восточной Азии, Сибири, Европейской и Центрально-азиатской популяций. Результаты показали, что суб-гаплогруппы Hg N имеют отдельного географического распределения. Высшая Y-STR разнообразия предков-Hg N суб-гаплогруппы наблюдалось в Южной части материковой Восточной Азии, и в дальнейшем филогеографических анализы поддерживает происхождения Hg N в Южном Китае. В сочетании с предыдущей данных, мы предполагаем, что в начале север разгон Hg N началась с Южного Китая около 21 тыс. лет назад (Кия), расширяя в Северном Китае 12-18 Кия и, достигнув дальше на север, к Сибири около 12-14 Кия, прежде чем рост населения и миграции на Запад, в Центральной Азии и в Восточной и Северной Европе около 8.0-10.0 Кия. Этот миграции на север Hg N аналогичным образом совпадает с отступающие льды листов после Последнего Ледникового Максимума (22-18 Кия) в материковой Восточной Азии.
            image.0066102.g004.png

            0
            • Starkoff
              26 декабря 2013  

              Это сегодня традиционная точка зрения - миграция N1c с Юга Азии через Восток на Запад.


              Но возможны ещё варианты в будущем. Например, монолитная часть на средней Лене вполне могла быть обратной разовой микроволной - "Эллей-Викинг". Сегодня это воспринимается шуткой, но учитывая "общего предка" примерно тысячелетие назад вполне может оказаться правдой...
              Будущее покажет. :)

              PS: Неадаптированные переводы невозможно читать, чесслово. Изложил бы своими словами... :)

              0
              • nathan
                nathan
                Ветеран
                26 декабря 2013  

                вполне могла быть обратной

                Не могла.см таблицу
                image

                0
                • nathan
                  nathan
                  Ветеран
                  26 декабря 2013  

                  Что видим

                  Якутская М 178 ветвь,первична по отношению к остальным)

                  0
                  • Starkoff
                    26 декабря 2013  

                    А захоронения на территории первичны ли? :)

                    0
                    • nathan
                      nathan
                      Ветеран
                      26 декабря 2013  

                      Что там удумал

                      Топикстартер с якутским модальным гаплотипом N-L708.

                      image
                      смотрим кортирко

                      0
                      • nathan
                        nathan
                        Ветеран
                        26 декабря 2013  

                        Четвертый сверху

                        У него два сына,один в Якутии другой на шабашку укатил на запад,там женился на аборегенке. У него два внука,один латыш другой суоми.

                        0
        • Starkoff
          26 декабря 2013  

          Сорри, а гаплогруппа "С" не палеоазиатская разве?

          0
          • ячс
            26 декабря 2013  

            Конечно нет вот

            C встречаются с высокой частотой среди аборигенов Австралии, папуасов, меланезийцев, полинезийцев, вьетнамцев, казахов, монголов, маньчжуров, корейцев и аборигенных народов Дальнего востока России (юкагиры), а также с умеренной частотой в Индии и Юго-восточной Азии. С другой стороны, гаплогруппа D встречается с высокой частотой только среди тибетцев, японцев (особенно айнов) и жителей Андаманских островов, однако не обнаружена ни в Индии, ни среди индейцев или аборигенов Океании.

            0
          • 1
            26 декабря 2013  

            это чингисхановская

            муслим казахский же говорил, что в Казахстане распространены С и R.
            Один потомки чингизидов, второй потомки арабских миссионеров.

            0
  • СуоК
    26 декабря 2013  

    Эх, муть подлатая.

    Скоро академическая наука докажет, что человек не без космического (Тангрианского) вмешательство не смог сотвориться, что тогда ?
    Вот тогда и скажете:
    - кто свиноподовный
    - кто обезьяноподобный
    - а кто, и от Аар Айыы.

    0
    • 1
      26 декабря 2013  

      а чо сакраловцы молчат?

      странно даже...

      0
      • Никон2
        26 декабря 2013  

        Наша позиция не изменилась.

        Сколько раз твердить:
        Никакого палеазиатства нет.
        Галлогруппы Саха = изначальная Отчие.
        Остальные - мутации от саха.
        Такие как русские, финны, тунгусы все они производняк от Саха.

        Остальные минус хоровиты.
        С.учья масти, увы

        0
        • offen
          26 декабря 2013  

          запомните эти цифры:

          у саха преобладает гаплогруппа 1Nc (87,4 %),
          затем идет R1a1 (3,2 %),
          C3c - 2,9 % и
          1N1b - 2,1 %.
          Оставшиеся незначительные проценты принадлежат другим гаплогруппам.

          0
          • 1
            26 декабря 2013  

            не у саха

            а у жителей одной деревни из Усть-Алдана.
            Отсюда и однородность, наверное и фамилия там на 99% одна типа Никифоров, или Жирков или Горохов и т.д.п.
            Но это не значит, что все саха имеют фамилию Жирков, для наглядности.
            Интересно у респондентов почему фамилии не записали?

            0
            • Никон2
              26 декабря 2013  

              Ну это твои сомнения

              Развей их в морозе, или доказни обратное.
              До этого помолчи в тряпочку.

              0
              • 1
                26 декабря 2013  

                никон а твая памилия

                или попов или христофоропф?
                И кровь свою ты никогда не сдашь для генофонда.
                Забракуют.
                Я, уже почти 10 лет твержу, что самые неистовые нацики это полукровки разных мастей от Быйанга, Леонида, Балая и естесно тебя, тундро-муориинес.

                0
            • Starkoff
              27 декабря 2013  

              А я верю в качество выборок. В своё время тему эту прилично здесь перетёрли и узбагоились... :)


              Если сами недовольные ребята-саха успокоились, то и мне нет смысла не верить. :)

              0
              • nathan
                nathan
                Ветеран
                27 декабря 2013  

                Одна однерка негодуэ

                Как так то,на их стороне наука,а у меня лишь пук в лужу,и остается лишь пукнуть и сидеть на берегу лужи и глядеть,как круги расходятся,хихикая и умиляясь.)))

                0
                • Starkoff
                  27 декабря 2013  

                  Имеет право на сомнение. Как и всё мы. :)


                  Когда-то здесь сомневающихся в релевантности выборок было гораздо больше, но постепенно уверовали после прочтения документов. Лишь сомневаются по-прежнему в расчёте времени начала нации Саха, определённому до общего предка всех местных N1c - не могут принять эту цифру, она роняет все представления и фантазии. :)
                  Но саму гаплогруппу приняли...

                  А я удивлён такой двойствености восприятия. Наукой эти даные подаются парой, вместе. Саха - носители гаплогруппы N1c, время жизни общего предка примерно 1300 лет назад (самая древняя цифра из посчитанных). Ранее по всей Якутии N1c не прослеживается...

                  0
                  • Starkoff
                    27 декабря 2013  

                    Кстати, его сомнение - как раз путь к удревнению. Если не N1c, то время можно произвольно удревлять.


                    Вплоть до Автохтонности или вообще Первозданнности на месте, Первотворении Саха. Привет Никону и Кылбару - Единёрка как самый ярый их сторонник получается. Они об этом просто не догадываются. :)

                    0
                    • nathan
                      nathan
                      Ветеран
                      27 декабря 2013  

                      Вот и хорошо

                      Пусть остается неведении,меньше знаешь крепче аргументы.Есть повод поглумиться)))

                      0
          • 1
            26 декабря 2013  

            что взять у дурака кроме анализов?

            А почему не обслдедуют Вилюйчан и Северных якутов (долган)???
            Иначе результаты могут отличаться от ожидаемых и проплаченных?

            0
            • Starkoff
              31 декабря 2013  

              Были же. Долганы точно в какой-то выборке были.

              0
            • Starkoff
              31 декабря 2013  

              Нашёл упоминания. Фёдорова у Долган делала выборки.


              Но у неё как-то в общем, Долганы - "смешаный этнос".
              Ещё из свеженькой диссертации некоего Харькова и статьи некоего Байтасова следующие цифры по Долганам:

              С - 37,3%
              N1c1 – 22,4%
              N1b – 11,9%
              R1a – 16,4%

              Но это русские публикации, оперирующие данными импортной работы 2004 года -
              http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1181943

              А вообще и по долганам в частности здесь в своё время говорили leonid и offen. Для меня это явное свидетельство, что такие работы были. :)

              0
              • sakha
                7 января 2014  

                верить можно только независимым исследованиям

                Есть работы статьи что долганы - генетически сагайцы
                Сагайцы - хакасы.
                Потому у долганов показатели такие как и у хакасов. А вот как раз таки надо верить импортным исследованиям. А наши имеют политические цели и задачи. Потому им и веры нет

                0
  • 1
    27 декабря 2013  

    акак связаться с адамовым?

    ему совет пусть даст на интерпретацию никону)))
    Зачем Париж, Лондон и тем более Талллллин.

    Цитата:
    До февраля 2014 года ждем результатов углубленного изучения моего собственного образца на наличие SNP мутаций, характеризующих якутскую ветвь гаплогруппы N1c1. По моим расчетам, этих снипов должно быть 10-15 штук. Далее будем определяться, какие снипы у Вас тестировать.


    Щас посмотрю, что пукнеееет Пёдорова, через год пранцузы и потом дам вам СВОЮ интерперетацию)))
    Так и Я могу, заказные гранты не выходя из ИСТа отрабатывать.

    0
    • tifedorov
      tifedorov
      Тимур Федоров
      27 декабря 2013  

      ты че весь извелся-то? че с тобой не так?

      0
      • 1
        27 декабря 2013  

        наш ТЫ пёдорофф

        оказался Харданой?
        Сардана Пёдорова?
        Ясно сваете...((но, ВЫ гранты отроабаеты

        0
      • Никон2
        27 декабря 2013  

        Да у него тунгусокрал уплывает их рук.

        1ке неймется делать из нас китайцев, чтобы претворить коварный замысел:
        оттяпнуть и отдать до Урала китайцам.
        А гены этому противоречат и играют на саха и русскую правду.
        Вот он и бесится.

        0
  • 1
    29 декабря 2013  

    япона мать...

    Цитата:
    Учёный из Японии ищет связь между жителями Хоккайдо и народами Севера
    Учёные ищут связь между жителями японского Хоккайдо и малочисленными народами Севера.

    Японский учёный Накада Ацуси, научный сотрудник «Музея народов Севера» в Хоккайдо, побывал с визитом в Алданском районе Якутии. Ученый встретился с эвенками, оленеводами, мастерицами, изучал быт, обычаи и обряды малочисленных народов Севера.

    Хоккайдо – самый северный остров Японии. Есть гипотеза, что его жители – айны – произошли от одного из северных народов. Приезд Накада Ацуси в Алданский район – попытка найти связь между жителями японского Хоккайдо и Якутии.
    Музей народов Севера, где собраны археологические находки, домашняя утварь, одежда, головные уборы, обувь, предметы быта и украшения народов Севера, был открыт в Хоккайдо двадцать лет назад. В страну восходящего солнца ученый увез предметы охотничьего снаряжения, эвенкийские амулеты и обереги для пополнения коллекции музея, сообщает пресс-служба администрации Алданского района.

    0
  • 1
    29 декабря 2013  

    терминология

    Цитата:
    Мин сахабын, мин булчут хаан удьуорабын. Киhи кыбыстара онно туох да суох.
    Я якут, охота это мой образ жизни, охота в нашей крови и мне нечего стыдиться за то что в наших генах это есть.

    0
  • сср
    30 декабря 2013  

    ..результат...

    ...если ты пьешь спиртное то ты я-мин кут-наливай...саха это те кто не пьет ведет здоровый образ жизни...занимается спортом собой...имеет крепкую семью...в якутске в основном живут я-куты...и мы добьемся чтоб наша Родина была отдельным государством...как Саудовская Аравия...а быть рабами мы не хотим

    0
  • LEONID
    30 декабря 2013  

    tifedorov зря радуешься. есть одна мелочь, которую и проталкивает Адамов


    Цитата:
    Популяции, у которых доминирует гаплогруппа N1c, говорят на языках уральской семьи. Это манси, ханты, саамы, финны, карелы.


    Он ещё пытается якутов с бурятами связать. Точнее бурятов поставить над саха. Почитай его работы спокойнее.

    0
    • tifedorov
      tifedorov
      Тимур Федоров
      31 декабря 2013  

      Адамов ничего такого пока не протакливает

      у него строго научный, практически математический подход. Нет никаких "проталкиваний" и прочего. На сегодняшний день ситуация такова, что происхождение саха можно объяснить и без уральского влияния. Так как среди гаплотипов народов уральской семьи (финны, ханты, манси и прочие) нет похожих на якутский кластер. Вот и все.

      0
      • LEONID
        31 декабря 2013  

        Как это нет? Ненцев забыли?

        Да и N1c1, как раз с тунгусами связывают.

        0
        • 1
          31 декабря 2013  

          лёнька, уже Эффес в голову торкнул

          с какого жуя это тунгуская N, это же чистопородная северно-азиатская (палеоазиатская).
          А тунгсуо это чингизиды, есть версия что Тенгис каган это забайкальский тунгус, главное очень правдободобная, это не Олонхо.
          Кстати с Новым Годом! Почему то в этом году нет поздравлений на ИСТе((

          0
        • кылбар
          31 декабря 2013  

          С Леонидом

          можно согласиться. В головах ученых-генетиков прочно сидит мысль об генетической идентичности бурят и якутов. Мол, нет народа ближе якутам чем буряты. Оказывается еще и ставят бурят выше. Это они и проталкивают.

          0
          • Starkoff
            1 января 2014  

            Странное высказывание поперёк именно генетических данных. Ты откуда такое взял? :)

            0
            • LEONID
              6 января 2014  

              Starkoff

              image

              0
              • Starkoff_
                6 января 2014  

                Эту таблицу я и в первоисточнике не понял - какие-то отношения "клавных компонент"...


                Мне нужны пояснения, неграмотный я... :)

                0
                • LEONID
                  6 января 2014  

                  Там дано пояснение

                  Цитата:
                  Наибольшая частота гаплогруппы N1с1 характерна для якутов (до 90%) и восточных бурят (до 85%). Значительна ее доля также у чукчей (61%), коряков (24%), телеутов (29%), эвенков (34%) и тувинцев (19%). Учитывая, что эти этносы относятся к различным языковым группам и семьям, очевидно, что маркируемый этой гаплогрупой генетический компонент (вероятно связанный с аборигенами таежной зоны) присутствовал в Сибири задолго до того, как упомянутые этносы приобрели присущие им лингвистические различия. Следы этой общности, несмотря на дальнейшие различия в истории популяций и контакты с населением сопредельных территорий, отчетливо выявляются в их современных генофондах.

                  0
  • )
    1 января 2014  

    :

    Да, пришел конец моим смеху.....кам. Раньше всегда смеялся над теми, кто бил себя пяткой в грудь, что он настоящий саха. Вот будет в музее эталон саха, как в Париже эталон метра, тогда типа и поговорим. Всегда завидовал самоуверенным типам. Сам сама неуверенность. Многая знание- многая печали. Но все равно уверен, что саха образовались здесь на основе пришлого и автохтонного материала. Те кто пришли сюда были курыкане или татары, но как саха мы сложились здесь. Да в этом ничего нового, но таково мое убеждение. Нацию делают не только гены.

    0
  • интересно
    4 января 2014  

    tifedorov , у тебя какая группа крови?

    0
  • Анна_
    6 января 2014  

    я вотдумаю. почему мы саха так держимся за свою исключительность?

    почему не молчим как другие великие народы? англичане или французы?

    может в нас действительно говорит зов великих предков??? или это самозащита от другой крайности, когда нам твердят о том, что мы сами пришлые, без роду и племени? (((

    0
    • Starkoff_
      6 января 2014  

      Все верят в свою исключительность (с) Макар :)


      Большинство молчит, ибо кричать неуместно.
      Кричат эпатажные и ущемлённые. Они есть всегда. По закону "Пяти процентов" кричащих всегда будет до 15% от численности населения - 5% активистов и два раза по пять сочувствующих.

      Кстати, сюда прекрасно примешивается и "зов великих предков" тоже. :)
      Не важно, о каком народе идёт речь...

      0
      • Анна_
        6 января 2014  

        а вы Старкофф_, куда себя причисляете? в 5 процентных?

        или в судьи?

        0
        • Starkoff_
          6 января 2014  

          Боже упаси быть судьёй, хотя и имею своё мнение. :)


          Я, скорее, сторонний наблюдатель из числа 85% большинства. :)

          0
    • СуоК
      6 января 2014  

      \ я вотдумаю. почему мы саха так держимся за свою исключительность? - Анна_\

      И не только Саха.
      Многие этносы придерживаются этого, кроме представителей т.н. суперэтносов т.к. они перемещены настолько, что немогут разобраться кто они, зачем они.Это происходит от того, что т.н. в свою историческую сущность предки этих представителей "впитывали уонна впитывали" культуру и семена других этносов, пока не слились в т.н. суперэтнос, в ихнем генномутированном составе кого только нет.
      Этничные тем и превосходны, что в основном "выкармливают уонна выкармливают" ненасытную утробу т.н. суперэтносов, пока не сольются с ними.
      У этничных как говорят "Зов предков", они стараются это сохранить, Ибо Аар Айыы(Арий) создал их такими.Прелесть и богатство Айыы (Природы) в РАЗНООБРАЗИЕ.Но мать-Природа в опасности, его убивает перенаселенность планеты - исчадия от суперэтносов.

      0
      • oidov
        7 января 2014  

        Вранье: - Кто говорит об исключительности? ??

        Только сакральщики, также о плюсах и минусах.
        Большинство знают, что все этносы или народы ЕвроАзии , так или иначе связаны не только Великими историями, но и генно.
        Просто у больших народов есть общие предки, а у малых они 500от лет от силы , так считают " политики" - государств . На это субьективные и обьективные причины.
        Многие высокомерно утверждают, Вы образовались 300то лет назад и т. д и т. п.Забывая общность людей, одного языка, и т.д. ,образовывалась задолго до образования государст и ее териториальных границ.
        Историю саха можно расматривать как. общую , на територии от Ледовитого до Монголии и Китая , на западе до Енисея, это последнии 1200и лет.
        Если брать 2000и лет и больше, она захватывает обитание Монголии и Северного Китая. А следы предков доходили до Европы и Скандинавии.

        0
        • СуоК
          7 января 2014  

          \ Кто говорит об исключительности? ?? - oidov\

          Например евреи - своей богоизбранностью.

          0
          • offen
            8 января 2014  

            на Земле остались 2 древних народа: евреи и саха

            Айсен Дойду: новый взгляд на
            древнюю историю народа Саха

            0
            • LEONID
              8 января 2014  

              Надо найти череп дюктайца и поставить точку в этом вопросе. :D

              0
              • offen
                8 января 2014  

                Попроси Ю.Мочанова:-)

                Следы дюктайцев в последние 10–12 лет найдены на огромных
                территориях между Алданом и
                Беринговым морем. Вполне
                возможно, считает один из
                первооткрывателей этой культуры
                Ю. А. Мочанов, что ее ареал
                охватывал не только территорию к
                востоку от Лены и к северу от
                Амура, но и, очевидно, Сахалин и
                большую часть Хоккайдо.
                И здесь мы вплотную подходим к
                интересующему нас вопросу. Ибо,
                как считает Ю. А. Мочанов, 35–40
                тысячелетий назад на территории
                Восточной Азии завершается
                формирование человека
                современного физического облика,
                обладающего
                протоамериканоидными чертами.
                Эти «протоамериканоиды»
                переходят через Становой хребет ии
                расселяются в бассейне средней
                Лены. Начиная с 35-го
                тысячелетия они осваивают
                обширные территории Якутии
                Чукотки. А когда около 20 тысячсвязь
                лет назад восстанавливается
                прерванная Воронцовской
                трансгрессией сухопутная
                Азии с Америкой, туда, вслед
                стадами мамонтов, бизонов и
                прочей живности проходит и
                человек.

                0
                • LEONID
                  8 января 2014  

                  Х-мм

                  Цитата:
                  35–40
                  тысячелетий назад на территории
                  Восточной Азии завершается
                  формирование человека
                  современного физического облика,
                  обладающего
                  протоамериканоидными чертами.


                  может уже нашли в пещере, да не хотят народ будоражить. Или в Алдан ящик с артефактами выкинули, теперь не докажешь. :D

                  0
                  • offen
                    8 января 2014  

                    писали: археологи кости и черепа обратно в землю закапавывают

                    им интересны украшения, предметы быта и т.д.

                    0
                    • LEONID
                      8 января 2014  

                      Прочитай ещё раз

                      Цитата:
                      завершается
                      формирование человека
                      современного физического облика,
                      обладающего
                      протоамериканоидными чертами


                      Откуда они знают какого они были облика?

                      0
                      • offen
                        8 января 2014  

                        кто они? цитата начинается со слов:

                        Ибо, как считает Ю. А. Мочанов, 35–40 тысячелетий назад ...

                        значит, Мочанову с Федосеевой виднее.

                        0
                        • LEONID
                          8 января 2014  

                          Виднее может быть только в одном случае

                          Я думаю ты помнишь знаменитую скульптуру майя якобы негроида.

                          0
  • offen
    8 января 2014  

    у исследователей различный взгляд на расовый тип

    Непосредственное знакомство с этими изваяниями заставляет решительно отказаться от внешнего сходства их с негроидным расовым типом. И в самом деле африканцы - это, как правило, длинноголовые люди с сильно выступающей нижней
    частью лица, в то время как ольмекские скульпторы, напротив,
    изображают круглоголовый, монголоидный тип.
    В болотистых джунглях Южной
    Мексики до сих пор можно
    встретить чистокровных индейцев, как две капли воды похожих на
    древние статуи ольмеков.

    0
  • Starkoff_
    8 января 2014  

    Да, там здоровенные такие головы негроидов...


    Несколько. И в джунглях периодически ещё находят. Непонятные факты...

    0
    • LEONID
      8 января 2014  

      Чтобы в этих башках увидеть негроидов надо очень захотеть

      0
      • Starkoff_
        8 января 2014  

        Кого ещё можно увидетьв этих Губах и Носах?


        Если монголоида, то весьма-весьма своеобразного, ныне не существующего. :)

        0
        • LEONID
          8 января 2014  

          Starkoff_

          Цитата:
          Упоминаемые мексиканские скульптуры с «негроидными» чертами из Чичен-Ицы и Тустлы скорее следует рассматривать как курьез, а не как серьезное доказательство.

          (...)

          http://www.korabli.eu/blogs/geograficheskie-otkrytiya/drevnie/afrika-i-novyy-svet

          0
          • Starkoff_
            8 января 2014  

            Ссылка, для тебя не типичная - не на научную работу. :)


            Мнения человеческие всегда разнообразны. А я ничего не доказываю. :)
            Этих "курьёзов" уже найдено около 20 штук по всей центральной Америке... Они не типичны и непонятны.

            0
          • oidov
            8 января 2014  

            Откуда у них эти рисунки?

            Квадрат, круг и крест вроде бы?
            Почему фон черно белый?

            0
          • oidov
            8 января 2014  

            Откуда у них эти рисунки?

            Квадрат, круг и крест вроде бы?
            Почему фон черно белый?

            0
            • oidov
              8 января 2014  

              Треугольника нет?

              0
              • oidov
                8 января 2014  

                Видимо фантазия современного художника?

                0
              • oidov
                8 января 2014  

                Добавлю, квадрат и круг, это сакральные символы

                Китая, Индии и Тибета - также религиозные - Круг в квадрате.
                Это связано с мировозрением. Трактовок множество.

                0
                • oidov
                  8 января 2014  

                  Раз молчат, выдам версию:

                  Это инопланетяне или пришельцы.
                  1.Сзади у них балоны из сопел идет "пламя ".
                  2.Сзади у них хвост или шланг, для "масок ".
                  3.Они выше ростом индейцев.
                  4.На рисунке они обращают в Веру, или вводят Душу -Кут, в индейца.
                  Поясню: Крест означать: - Четыре конца Света, Четыре стихии Земля, Вода, Воздух, и Огонь, также может видимо означать Инь и Янь по простому " Ад и Рай" , что то вроде этого.
                  Не Понятно одно: - Первому индейцу "вводят" четыре Кут - Души, а второму один Кут - душу.
                  Поясню для не знакомых с иными Верами.
                  Кут это душа, Например древние саха верили, что при рождении ребенка: - Боги брали "Душу" земли, " Душу "Воздуха и вселяли в душу женщины.
                  Салгын кут , Буор кут и вселяли в ийэ кут . Но не понимайте прямо кут и душа видимо понятия более глубокие может и разные? ??
                  На рисунке майа вселяют четыре кут или " крестят ".в первого индейца.
                  Во второго индейца вселяют одну стихию - кут. Огонь, Воду, Воздух или Землю? ??

                  0
                • oidov
                  8 января 2014  

                  Раз молчат, выдам версию:

                  Это инопланетяне или пришельцы.
                  1.Сзади у них балоны из сопел идет "пламя ".
                  2.Сзади у них хвост или шланг, для "масок ".
                  3.Они выше ростом индейцев.
                  4.На рисунке они обращают в Веру, или вводят Душу -Кут, в индейца.
                  Поясню: Крест означать: - Четыре конца Света, Четыре стихии Земля, Вода, Воздух, и Огонь, также может видимо означать Инь и Янь по простому " Ад и Рай" , что то вроде этого.
                  Не Понятно одно: - Первому индейцу "вводят" четыре Кут - Души, а второму один Кут - душу.
                  Поясню для не знакомых с иными Верами.
                  Кут это душа, Например древние саха верили, что при рождении ребенка: - Боги брали "Душу" земли, " Душу "Воздуха и вселяли в душу женщины.
                  Салгын кут , Буор кут и вселяли в ийэ кут . Но не понимайте прямо кут и душа видимо понятия более глубокие может и разные? ??
                  На рисунке майа вселяют четыре кут или " крестят ".в первого индейца.
                  Во второго индейца вселяют одну стихию - кут. Огонь, Воду, Воздух или Землю? ??

                  0
                  • oidov
                    8 января 2014  

                    Версия: -На рисунке запечатлена " Легенда "

                    Как боги создавали Человека.
                    В масках это " боги ".
                    Первому дают Знания и Душу Четырех стихий - Крест - он будет в дальнейшем-Жрецом.
                    Второму дают Вселяют- дают душу Кут. - он будет простым мирянином.
                    Ошибка: - Правильно вероятно - Огонь, Воздух, Земля и Кут от Бога. ?

                    0
                    • oidov
                      8 января 2014  

                      Версия: - Может Я Кут - означало Крещенный - верующий ???

                      У древних несторианский крест - равносторонний означал многое, одно из значений дошедший через Олонхо Салгын кут, Буор кут, Ийэ кут и вероятно Огонь? ?? Четыре конца креста.

                      0
  • offen
    8 февраля 2014  

    tifedorov, расшифруй пожалуйста мой результат

    Мои совпадения: Y17

    Совпадения в популяционной базе данных по гаплотипу из 17 маркеров (версия R14)
    Совп.    Δ    Популяция    Регион    Страна    SNP    Выборка    
    Совпадение 17 из 17 маркеров    17/17    0    Якуты    Якутия    Россия        12 из 41    
    Совпадение 17 из 17 маркеров    17/17    0    Якуты    Якутия    Россия        10 из 92    
    Совпадение 17 из 17 маркеров    17/17    0    Якуты    Якутия    Россия    TAT    2 из 0    
    Совпадение 16 из 17 маркеров    16/17    1    Якуты    Якутия    Россия        1 из 92    
    Совпадение 16 из 17 маркеров    16/17    1    Якуты    Якутия    Россия    TAT    1 из 0    
    Совпадение 16 из 17 маркеров    16/17    1    Якуты    Якутия    Россия        2 из 92    
    Совпадение 16 из 17 маркеров    16/17    1    Якуты    Якутия    Россия        1 из 92    
    Совпадение 16 из 17 маркеров    16/17    1    Якуты    Якутия    Россия        1 из 92    
    Совпадение 16 из 17 маркеров    16/17    1    Якуты    Якутия    Россия        15 из 92    
    Совпадение 16 из 17 маркеров    16/17    1    Якуты    Якутия    Россия        1 из 92    
    Совпадение 16 из 17 маркеров    16/17    1    Якуты    Якутия    Россия        1 из 92    
    Совпадение 16 из 17 маркеров    16/17    1    Якуты    Якутия    Россия        1 из 41    
    Совпадение 16 из 17 маркеров    16/17    1    Якуты    Якутия    Россия        1 из 41    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        5 из 92    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        1 из 92    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        1 из 92    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия    TAT    1 из 0    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        4 из 92    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        1 из 92    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        2 из 92    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        1 из 41    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        1 из 92    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        15 из 41    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        1 из 92    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        1 из 92    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        1 из 92    
    Совпадение 15 из 17 маркеров    15/17    2    Якуты    Якутия    Россия        1 из 92    

    В таблице приводится гаплотип из локусов и их значений (аллелей):

    DYS 389-1
    14
    DYS 389-2
    32
    DYS 390
    23
    DYS 456
    14
    DYS 19
    14
    DYS 385a
    11
    DYS 385b
    13
    DYS 458
    16
    DYS 437
    14
    DYS 438
    11
    DYS 448
    19
    Y-GATA-H4
    12
    DYS 391
    11
    DYS 392
    16
    DYS 393
    14
    DYS 439
    10
    DYS 635
    22

    0
    • offen
      9 февраля 2014  

      сравним

      14-23-14-11-11-13-11-12-10-14-16-32.- tifedorov

      14-32-23-14-14-11-13-16-14-11-19-12-11-16-14-10-22 - offen

      но не написали гаплотип - требуют еще оплатить 3900 руб.
      хер им, написали якут, а дальше неинтересно.:-)

      0
      • nathan
        nathan
        Ветеран
        9 февраля 2014  

        Выходит I2b2-S154 вероятность- 100%

        14-32-23-14-14-11-13-16-14-11-19-12-11-16-14-10-22

        0
      • гыгы999
        9 февраля 2014  

        Оффен ты какой-то не такой гыгы

        Наверное в 70-80 гг. родился? Разброс по аллелям слишком большой для саха.

        0
        • nathan
          nathan
          Ветеран
          9 февраля 2014  

          Нормально ,корни скорее ведут в Польшу.

          В последние годы оно постепенно стало ясно, что гаплогруппе я-L38 имеет несколько отделений:

          Я-L38-L533
          В 2012 году стало ясно, что SNP L533 отделяет гаплогруппе я-L38. До сих пор только 6 образцов FTDNA я-L38 проект оказался L533 положительные. DYS385a,b=13, 14 и DYS454=11, кажется, STR-подпись я-L38/L533.
          Я-L38-L69
          В 2013 году трех членов FTDNA я-L38 проекта, оказалось, разделяют те же L69/S163/rs9786274 = T,T мутации, делая SNP L69 втором отделении я-L38. Все они принадлежат к УЛ кластер характеризуется DYS 448=22 и DYS393=14 с подозрением на Восточно-Европейской истории.
          Я-L38-F780
          Также в 2013 году, один из FTDNA я-L38 участников проекта (подтверждение SNP L38+) взял Geno2.0 тест. Его отцовской линии набирается Национального Genographic project, а я-F780. Этот пример был,G для SNP F780 в то время как все другие, я-L38 членов с известными F780 результаты проверены G,G на этот SNP. SNP F780 указывает на третью ветвь я-L38

          0
    • tifedorov
      tifedorov
      Тимур Федоров
      9 февраля 2014  

      не слушай их, N1c1 у тебя

      N    Haplogroup    Probability
      1    N1c1*-M178*(xL550)    71%

      http://predictor.ydna.ru/

      0
      • nathan
        nathan
        Ветеран
        9 февраля 2014  

        Вот что выдает

        image

        0
        • tifedorov
          tifedorov
          Тимур Федоров
          9 февраля 2014  

          ну так конечно, забиваете 17 маркеров в куйзнаетсколько-маркерный предиктор

          вы по номерам маркеров то смотрите. Там в опциях надо поменять на 20 маркеров (Y-Filer order 2).

          0
  • LEONID
    9 февраля 2014  

    offen

    Куда подавал? Сколько стоит? Как связаться с ними?

    0
  • гыгы999
    9 февраля 2014  

    Хм странно. Тогда надо посчитать гаплотип якутский по новому.

    Цитата:
    14-23-14-11-11-13-11-12-10-14-16-32.- tifedorov

    14-32-23-14-14-11-13-16-14-11-19-12-11-16-14-10-22 - offen

    Тогда возраст вообще древнейший окажется?

    0
    • tifedorov
      tifedorov
      Тимур Федоров
      9 февраля 2014  

      у нас разное кол-во маркеров, у меня 12, у него 17

      но по значениям маркеров наверно одинаково.
      DYS393 - 14, DYS390 - 23, DYS19 - 14, DYS391 - 11, DYS385a - 11, DYS385b - 13, DYS426 - 11, DYS388 - 12, DYS439 - 10, DYS389I - 14, DYS392 - 16, DYS389II - 32
      а теперь сравните с offenовским результатом по маркерам

      0
      • nathan
        nathan
        Ветеран
        9 февраля 2014  

        После нехитрых манипуляций ,пальцами

        Вышел наконец Оффен якут.. N1c1*-M178*(xL550) 71%)))

        0
      • offen
        9 февраля 2014  

        более наглядно - где совпадение?

        tifedorov
        DYS393 - 14, DYS390 - 23, DYS19 - 14, DYS391 - 11, DYS385a - 11, DYS385b - 13, DYS426 - 11, DYS388 - 12, DYS439 - 10, DYS389I - 14, DYS392 - 16, DYS389II - 32

        offen
        DYS 389-1 - 14, DYS 389-2 - 32, DYS 390 - 23, DYS 456 - 14, DYS 19 - 14, DYS 385a - 11, DYS 385b - 13, DYS 458 - 16, DYS 437 - 14, DYS 438 - 11, DYS 448 - 19, Y-GATA-H4 - 12, DYS 391 - 11, DYS 392 - 16, DYS 393 - 14, DYS 439 - 10, DYS 635 - 22.

        0
  • гыгы999
    9 февраля 2014  

    Заметки о гаплогруппах Y- хромосомы якутов. Дмитрий Адамов

    Расчет возраста общего предка по мужской линии для «чайников», Дмитрий Адамов
    http://ru.scribd.com/doc/29595431/Russian-Journal-of-Genetic-Genealogy-Русская-версия-Том-2-№1-2010-г
    Расчет возраста общего предка по мужской линии для «чайников», Дмитрий Адамов
    http://ru.rjgg.org
    МОГУЛ как математик попробуй сам подсчитать общего предка по мужской линии используя эти числовые данные по методике Адамова:
    14-23-14-11-11-13-11-12-10-14-16-32.- tifedorov

    14-32-23-14-14-11-13-16-14-11-19-12 - offen

    0
    • offen
      9 февраля 2014  

      что-то в этих ссылках никак (там понаписано по английски)

      никак не могу загнать свои данные

      0
    • гыгы999
      9 февраля 2014  

      Общий предок для Тифедорова и Оффена, подсчет для чайников.

      Происхождение якутов связано с гаплогруппой N1c1, обнаруженной у 87% мужчин(таблица 1). Считается, что гаплотипы якутов N1c1 образуют отдельный кластер с четко выраженным эффектом основателя. Гаплотип предка якутов N1c1 в 17-маркерном представлении:
      14-11-13-14-32-23-11-16-14-14-11-10-19-14-16-22-11. Вот основатель.
      Потомоки основателя:
      14-23-14-11-11-13-11-12-10-14-16-32.- tifedorov -

      14-32-23-14-14-11-13-16-14-11-19-12-11-16-14-10-22 - offen

      Цитата:

      Расчет возраста общего предка по мужской линии для «чайников» Д.С. Адамов

      Введение

      Вы–обладатель 12-маркерного или 17-маркерного гаплотипа Y-хромосомы (собственной, отца, мужа, брата и т.д.) только начинаете знакомство с миром ДНК-генеалогии. Перед тем, как подсчитать эту статью, рекомендую ознакомиться с содержанием двух основных российских Интернет-ресурсов ДНК-генеалогии :http://www.molgen.org/http://www.rodstvo.ru/
      1.
      Два гаплотипа Вы нашли гаплотип, полностью совпадающий с Вашим. Какова
      степень родства между обладателями двух одинаковых гаплотипов?
      Теория вероятностей говорит,что однозначного ответа нет. Если совпали 12-маркерные гаплотипы, то общий предок обоих мужчин отстоит от нынешнего времени в интервале от 1 до 77 поколений. Вероятность этого 95%. При совпадении двух 17-маркерных ситуация чуть лучше-общий предок жил от 1 до 54 поколений назад. Гораздо лучше, если ваш гаплотип определен по 67 маркерам. Тогда общий предок двух идентичных
      гаплотипов попадает в интервал от 1 до 14 поколений. Для того, чтобы достоверно определить генетического отца, потребуется сравнение гаплотипов содержащих не менее 500 одинаковых маркеров.
      Ваш гаплотип редкий, совпадений не нашлось. Но есть гаплотипы, отличающиеся от вашего на единицу, то есть по одному из маркеров количество повторов отличается на единицу. например. вместо 11 у Вас, в сравниваемом маркере стоит 12 (или 10). По другим маркерам числа совпадают. В этом случае родство в среднем отдаляется. Отличие на единицу между двумя 12-маркерными гаплотипами помещают общего предка в интервал от 6 до 122 поколений назад. Для 17-маркерного гаплотипа–от 6 до 85 поколений назад.
      Если два 67-маркерных гаплотипа отличаются на единицу, то общий предок
      жил от 1 до 22 поколений назад.

      Отсюда выходит, что общий предок для Оффена и Тифедорова Саха жил..хрен знает когда
      Цитата:
      Отличие на единицу между двумя 12-маркерными гаплотипами помещают общего предка в интервал от 6 до 122 поколений назад.
      Больше, чем 122 поколения гыгыгы

      0
  • гыгы999
    9 февраля 2014  

    А вот только заметил закономерность:

    14-11-13-14-32-23-11-16-14-14-11-10-19-14-16-22-11. Вот основатель.
    Потомоки основателя:
    14-23-14-11-11-13-11-12-10-14-16-32.- tifedorov -

    14-32-23-14-14-11-13-16-14-11-19-12-11-16-14-10-22 - offen
    Все равно разброс большой в различных аллелях.

    0
    • offen
      9 февраля 2014  

      основатель с какого местечка?

      14-11-13-14-32-23-11-16-14-14-11-10-19-14-16-22-11. Вот основатель.

      14-32-23-14-14-11-13-16-14-11-19-12-11-16-14-10-22 - offen

      0
      • гыгы999
        9 февраля 2014  

        Не знаю, это вроде когда французы раскопки проводили.

        У Адамова почитай.

        0
        • offen
          9 февраля 2014  

          тогда батулинец - бөрө бөтүҥ

          абыйцы шли на Север с Татты, Амги, Чурапчи - Өрөк Чөрөк-боотур нууччалар кэлиэхтэрин иннинэ Абыйы булбут этэ.
          разница около 400 лет : 50 = 8 поколений, при возрасте 25 лет 16 поколений.
          http://dnevniki.ykt.ru/offen/515867

          0
        • nathan
          nathan
          Ветеран
          9 февраля 2014  

          Вот

          image

          0
          • гыгы999
            9 февраля 2014  

            Эти монголы и тибетец даже ближе к основателю,чем Оффен)))

            0
          • oidov
            9 февраля 2014  

            Не знаю как читать эту китайскую грамоту.

            Почему с монголами совпадения по цифрам очевидны? ?? Ведь у них С какой то.
            А тут из 17и цифр, по две только разницы, даже порядок одинаков.
            Разницы этих монгол с саха 10~11: 32~31: 16~17. Или у них тоже N1с1???
            По " китайской грамоте " - цифр, поясни Натхан, пожалуйста! :-) :-) :-)

            0
          • oidov
            9 февраля 2014  

            Не знаю как читать эту китайскую грамоту.

            Почему с монголами совпадения по цифрам очевидны? ?? Ведь у них С какой то.
            А тут из 17и цифр, по две только разницы, даже порядок одинаков.
            Разницы этих монгол с саха 10~11: 32~31: 16~17. Или у них тоже N1с1???
            По " китайской грамоте " - цифр, поясни Натхан, пожалуйста! :-) :-) :-)

            0
            • nathan
              nathan
              Ветеран
              9 февраля 2014  

              Вот пояснения як

              image

              0
              • гыгы999
                9 февраля 2014  

                А про Сибо пишут Маньчжуры. А они ближе к саха.

                Цитата:
                Сибо (самоназвание: маньч. Sibe.png Sibe (сибэ), а также сибо, сибо маньчжу; кит. упр. 锡伯族, пиньинь: Xíbó Zú) — народ в Китае, входит в 55 официально признанных национальных меньшинств страны.

                Проживают главным образом на северо-западе Синьцзян-Уйгурского автономного района, и частично в провинциях Ляонин и Цзилинь. В русской литературе встречается также название сибинцы. Численность 188 824 человека (перепись, 2000).

                По происхождению и культуре сибо близки маньчжурам. Язык — сибинский диалект маньчжурского языка, письменность — маньчжурская. Религия сибо — шаманство. Основное занятие — земледелие, подсобные — животноводство, рыболовство. Традиционное жилище — каркасно-столбовое с тёплой лежанкой кан.

                0
            • oidov
              9 февраля 2014  

              По вашим цифрам, монголы ближе по генетике к саха, чем Оффен и.Тифедоров :-) :-) :-)

              Или они не саха.??? Шучу.
              Просто по порядковому номеру и цифрам, у монголов больше совпадений с.Геномом саха, чем у Ти Федорова и у Оффена.
              Теперь понятно или нет? рассярдятся еще? !:-) :-) :-) ,Генетики хе.хе :-) :-) :-) .

              0
              • Это Россия.
                9 февраля 2014  

                Много букв и цифр

                Ясно одно: Куча амбиций не состоявщихся учёных и маргеналов.

                0
                • oidov
                  9 февраля 2014  

                  Главные "обзывалки ":- явно не саха оказывается :-) :-) :-) .

                  0
                  • oidov
                    9 февраля 2014  

                    Вот и хань оказывается врал, что монголы от маньжу или тунгусов пошли.

                    Разница то, тоже ОГО Го - большая :-) :-) :-) . Что скажешь или Это Не Важно? ??:-) :-) :-)

                    0
                    • Не важно
                      9 февраля 2014  

                      Гастарбайтер Ойдов )))

                      Своего не имеет и к другим клеется, якутский язык не знает, а мнит себя исполином - ты ойдов не саха - ты засланный гастарбайтер.

                      Монголы и Буряты в отличие к примеру от тебя и некоторых - почему то не отрицают своего происхождения от прототунгусов Сяньби и Кидань да и эвенков как за родных братьев считают.

                      А по научному - У саха С3* всего 2,1% у тунгусов их 40% столько же у монголов - а вывод какой от этого получается??? Гастарбайтер псевдо саха Ойдов сложить не может! )))) Ему трудно! )))

                      Так что мечтай гастарбайтер Ойдов о ЧХ и монголах - а лучше съезди в Монголию и по кричи там что они произошли от Саха и что Саха истинные Монголы - разделают тебя как барана или оленя - лучше не езди ))))

                      0
                      • nathan
                        nathan
                        Ветеран
                        10 февраля 2014  

                        Про какие 40% С3*

                        Если про стар кластер, то у тунгусов.... Нуль.

                        0
                        • Не важно
                          10 февраля 2014  

                          Тюю ))) Не хитри Натан - старкластер - нашел отличе ))))

                          Не смеши Натан, и не мни себя умнее других - внимательно прочти таблицу привиденную тобою же. Пол статьи про тунгуские С3* выставил а половину спрятал хитрец ))))))

                          Цитата:
                          "К сожалению, в работе Xue et al. (2005) не определяли значения аллелей по двойному маркеру DYS385, что позволило выборку по крайней мере на две большие ветви: гаплотипы [b]«Star Cluster» группируются вокруг значений DYS385 = 12,13 (Derenko etal., 2007a)[/b], в то время как наиболее распространенный бурятский гаплотип имеет значения 11,18. По видимому, и эти гаплотипы принадлежат к различным, еще не открытым гаплогруппам в составе гаплогруппы С3*."


                          А якутский застывший старкластер 2,1% скорее залетный тунгусский ген - потому он не развивается в иные подвиды а тухнет сам по себе - по скольку якуты не носители данного подвида оно не развивается а просто законсервировался ))))))

                          Цитата:
                          C3-M217 (M217, PK2, P44) Встречается с высокой частотой среди бурятов, дауров, хазарейцев, ительменов, калмыков, коряков, маньчжуров, монголов, орочей и сибо, а также с умеренной частотой среди эвенков, корейцев, айнов, нивхов, алтайцев, тувинцев и узбеков


                          http://ru.wikipedia.org/wiki/%C3%E0%EF%EB%EE%E3%F0%F3%EF%EF%E0_C_(Y-%C4%CD%CA)

                          Что то саха тут в списке не видно.

                          300 лет саха и тунгусы соседствовали - а ты к примеру Натан знаешь всех своих предков в 17 и в 18 веке???? ))))))

                          0
                        • nathan
                          nathan
                          Ветеран
                          10 февраля 2014  

                          Знаю,до 17 точно.

                          0
                        • Не важно
                          10 февраля 2014  

                          От сюда и видно

                          Все твое приводимое - это ложь! Я был в нашем Якутском Архиве - там данные о родах можно найти только с начала 19 века ))) А уж до 17 века и я могу себе родословное олонхо придумать ))))

                          0
                        • Не важно
                          10 февраля 2014  

                          Так что как видно

                          Старкластеры тунгусов группируются во круг иного складывающегося подвида С3* - которые пока не раскрыли. То бишь они развиваются как у Бурят и Монголов. А у саха 2,1% просто законсервировались (застыли) - потому что саха не кореные носители данного подвида - потому и не развивается - стало быть они залетные. Так то Натан )))

                          0
                    • nathan
                      nathan
                      Ветеран
                      10 февраля 2014  

                      Взял лупу.... смотрел .....Нуль!

                      image
                      С3* - которые пока не раскрыли.Пока бы,да ка бы,если бы...бабушка была дедушкой...)))

                      0
                      • Не важно
                        10 февраля 2014  

                        Ты ссылку дай

                        А то суешь только вырванное из контекста и то что тебе на руку )))))
                        А про абы кабы дедушки бабушки - так это ученые же так колдут ))))
                        Давай ссылку полностью а не отрывками ))))

                        0
                        • nathan
                          nathan
                          Ветеран
                          10 февраля 2014  

                          Дерзай.

                          Эти стандартные 12 маркеров в правильном порядке следующие:
                          DYS# 383 - 390 - 19 - 391 – 385a – 385b - 426 – 388 – 439 – 389-1 – 392 – 389-2

                          Итак, гаплотип Чингиз-хана:
                          13 – 25 – 16 – 10 – 12 – 13 – 11 – 14 – 10 – 13 – 11 - 29

                          0
                    • Не важно
                      10 февраля 2014  

                      Я тебе тоже всякие цифры могу скинуть )))

                      Ты мне ссылку данной таблицы дай )))

                      0
                    • oidov
                      9 февраля 2014  

                      Извиняюсь Не Важно, перепутал с сибо.

                      Первые предки до восьми (дальше нет) у саха и тунгусов одинаковы.
                      А у монголов ( не знаю каких? ) , из 17ти всего три другие, и то на один шаг. У хупсугульских на два, и на один. Разницы 11~10: 16~17: 32~31:
                      Тогда чем отличается N1с1 или N1c от С3 ? Процентами? ?? Или тоже плаваете? :-) :-) :-)

                      0
                  • offen
                    9 февраля 2014  

                    oidov, ты это мягко говоря не 3,14зди

                    сравни: 14-32-23-14-14-11-13-16-14-11-19-12-11-16-14-10-22 - offen
                    http://rugiland.nar*od.ru/index/0-192
                    19.2.1. Гаплотипы из древних останков якутов

                    В недавней работе [Crubezy et al, 2010] были определены гаплотипы из 58 мумифицированных останков якутов, дати­руемых между 15 и 19 веками. Раскопки производились в Восточной Сибири в России, в Якутии.

                    Рис. 19.2.1.1. Дерево 17-маркерных гаплотипов якутов (гаплог­руппа N1c) с базовым (предковым) гаплотипом 14-23-14-11-11-13-Х-Х-10-14-16-18 -(
                    ·

                    ·)- 14-19-12-14-11-22
                    (в форматеFTDNA), погибших 200 - 600 лет назад и мумифицированных. В выборке 15 гаплотипов. Гаплотипы взяты из работы [Crubezyet al., 2010]. Гаплотип YAKa57 по данным цитируемой статьи не относиться к гаплогруппе N1c.

                    Дерево 17-маркерных гаплотипов, которых оказалось всего 15 (остальные были не определены, или имели пропу­ски в аллелях, или которые не смогли типировать на гаплог­руппы), из них 14 относились к гаплогруппе N1c, показано на рис. 19.2.1.1. Эти 14 гаплотипов имели всего 20 мутаций от базового гаплотипа
                    14-23-14-11-11-13-Х-Х-10-14-16-18-( …)-14-19-12-14-11-22 приведённого здесь в формате FTDNA (Табл. 5.2.3.1.2). 393-390-19-391 -385а-385Ь-Х-Х-439-3891-392-3892-458-(... )-437-448-GATAH4-456-438-635
                    Эти 20 мутаций указывают на общего предка популяции, который жил 1100±270 лет до смерти описанной группы яку­тов 200-600 лет назад. Интересно, что это то же самое вре­мя, что и для описанной в предыдущем разделе популяции якутов - наших современников (1600±200 лет назад), и базо­вый гаплотип их точно такой же, насколько можно сравнить две разных последовательности маркеров:
                    14-23-14-11-11-13-Х-Х-Х-14-16-18
                    Иначе говоря, это та же самая популяция якутов, только разделённая по времени несколькими столетиями.

                    0
                  • Это Россия.
                    9 февраля 2014  

                    Ну и живите своими амбициями в gavne

                    и в деградации современной якутской нации. Что тут сидите в дешёвом и в ни кому не нужном болоте? Что? Уже разменяли свою научную стезю на копейки и подачки? Мелко плаваете, господа - ботаники. До Коперника - вам далеко.

                    0
                    • offen
                      9 февраля 2014  

                      ну, Россия вообще запуталась в Ra1 u N1c1

                      причем N1c1 - основатели России-Московии (новгородцы, псковичи и кривичи-исконно неславяне)

                      0
  • offen
    9 февраля 2014  

    абыйцы раньше пришли на территорию Якутии, чем предполагаемый основатель ;-)

    14-32-23-14-14-11-13-16-14-11-19-12-11-16-14-10-22 - offen

    14-11-13-14-32-23-11-16-14-14-11-10-19-14-16-22-11. Вот основатель.

    видите семья повторяется: между 14 (тюрк) и 13 (монгол) вклинивается 11 на основателе?

    http://forum.molgen.org/index.php?topic=388.0

    0
    • oidov
      9 февраля 2014  

      По моему это ты причислял их к тунгусам.

      Говорил ведь тебе, Олонхо тоже часть сокровенных преданий. По Олонхо у них еще по материнской, должен быть ген Айыы, - скандинавов Евро ?

      0
      • oidov
        9 февраля 2014  

        Чисто прагматично, Вилюй древние тюрки и хунну, сүнну.

        Сүнну тарын - наледь сүнну, Сунтар дети хунну видать ? :-) :-) :-) .
        Человеку свойственно ошибаться, тем более обывателю :-) . Только не визжи как Не Важно :-) :-) :-)

        0
        • offen
          9 февраля 2014  

          oidov, я всегда считал уроженцев Бүтэй Бүлүү потомками тоҥ уус,ов

          о чем писал Г.В.Ксенофонтов
          http://ВК.com/gvksenofontov

          Ксенофонтов применяет оригинальную научную методику — на основе сопоставления различных исторических, фольклорных и языковых материалов анализирует глубинные явления, связанные с процессом этногенеза якутов. Им предпринимается попытка создания возможных моделей формирования, развития и контактирования с другими этносами якутского народа в его историческом пути. Он уделяет особое внимание т.н. северным (оленным), а также вилюйским якутам. Первые, согласно его версии, в процессе освоения северных территорий шли в авангарде якутского народа. А вилюйчане во времена древних переселений якутского племени шли впереди якутян — предков якутов центральных улусов (1. С. 109). Северные якуты, как пишет Ксенофонтов, по своему этническому происхождению представляют собой конгломерат из тунгусов, тюрок и монголов. А вилюйские якуты, ассимилировав здесь тунгусов, в этническом плане стали представлять тоже слияние двух этносов — якутов и тунгусов. Поэтому эти группы якутов в свое время являли собой своеобразные субэтносы по отношению к якутам центральных улусов. Однако современные историки-якутоведы считают, что основная масса вилюйских якутов являются выходцами из центральной Якутии (6. С. 7).

          Ксенофонтов, отметив разобщенное существование вилюйчан и якутян — первых на севере, а вторых на юге, пришел к версии, что данный процесс продолжался очень долго, вероятно, несколько столетий (2. С. 153).

          Самосознания составляющих частей якутского народа — якутян (якутов центральных улусов) и вилюйчан имели большие различия. Заметив данное явление, Ксенофонтов писал, что якутяне признают себя настоящими «саха», а вилюйчане — побочным и второстепенным отделом его (2. С. 176). При этом старинное название якутского племени было ураангхай, а саха — современное племенное самоопределение якутов (2. С. 176). Как было уже отмечено, в составе якутов присутствует достаточно многочисленная тунгусская прослойка, объякученная (тюркизированная) в незапамятной древности (2. С.187). Таким образом, предки современных саха еще с самых древних времен смешались с другими народами — тунгусами, монголами и т.д. И все это получило освещение в трудах Ксенофонтова.

          0
          • oidov
            9 февраля 2014  

            Настоящий тунгус это ты даже по менталитету улусника, даже по хромосоме.

            Вилюй древние тюрки, даже генетически старше и ближе.

            0
            • offen
              9 февраля 2014  

              oidov, сахалыы суруйаҕын дуо?

              даже Не важно догадался, что oidov-маргинал и манкурт (вместе взятые) ;-))

              0
              • offen
                9 февраля 2014  

                поищи в интернете

                [6] В этом плане обособленное положение занимает большая часть вилюйских якутов. Они, несмотря на гетерогенность в генетическом отношении, объединяются в группу палеосибирских монголоидов, т.е. эта группа (за исключением сунтарских якутов, которые принадлежат к представителям якутского населения Центральной Якутии) в своем составе несет древний палеосибирский компонент. (См.: Спицын В.А. Биохимический полиморфизм. С. 115).

                пля, непонятно как пишут

                0
    • nathan
      nathan
      Ветеран
      10 февраля 2014  

      DYS 391 - 11 Стандартный якутский)))

      0
      • offen
        10 февраля 2014  

        это работа Клесова?

        http://future-2008.livejournal.com/4235.html

        Сравните DYS:
        16 – 12 – 24 - 11 -11 – 13 -11 – 15 - 12 -10 -13 -30 – современный мужчина, славянин
        15 - 14 - 25 - 10 - 11 - 13 - 11 - 10 – 26 - Чизгиз-хан
        14 - 12 - 24 - 10 - 13 - 13 - 12 - 13 – 30 - Верховный король Ирландии Колла Уайс
        15 - 12 - 25 - 11 - 11 - 13 - 12 - 14 – 31 – ирландский король-воин Сомерленд
        15 - 12 - 24 - 10 - 15 - 13 - 12 - 12 - 27 - Томас Джефферсон


        1-й маркер DYS#19 показывает - к какому первопредку принадлежит человек:

        17 - праславяне, Южные Славяне
        16 - славяне
        15 - азиаты
        14 - негроиды, евреи, арабы
        12-13 - европейцы

        Чем короче запись 1-го маркера, тем позднее она начала записываться.

        0
  • Суулла Уола
    9 февраля 2014  

    Голову сломать можно с вашими гаплогруппами, аллелями

    ...

    0
    • nathan
      nathan
      Ветеран
      10 февраля 2014  

      По Клесову

      Эти стандартные 12 маркеров в правильном порядке следующие:
      DYS# 383 - 390 - 19 - 391 – 385a – 385b - 426 – 388 – 439 – 389-1 – 392 – 389-2

      Итак, гаплотип Чингиз-хана:
      13 – 25 – 16 – 10 – 12 – 13 – 11 – 14 – 10 – 13 – 11 - 29
      гаплотип Рюрика
      14 - 23 - 14 - 11 - 11 - 13 - 11 - 12 - Х - 14 - 14 - 30
      гаплотип Сталина
      14 – 23 – 15 – 9 – 15 – 16 – 11 – 12 – 11 – 11 – 10 – 28
      гаплотип Оффена
      14 - 23 - 14 - 11 - 11 - х - Х - 10 - 10 - 14 - 16 - 32

      0
      • offen
        10 февраля 2014  

        Сталин - северный осетин

        а они скифы?

        0
        • offen
          10 февраля 2014  

          пишут хазарин = еврей + тюрк (?!)

          Сталин не осетин и тем более не потомок алан. А JD *****овского розлива. А если быть точнее - хазарского.
          http://bela-rus.livejournal.com/8937.html

          0
          • offen
            10 февраля 2014  

            для сведения

            дочь Молотова Светлана (полуеврейка) была помолвлена с сыном Сталина Василием.
            http://s-mahat.ru/cgi-bin/index.cgi?
            cont=117
            - - - - - - - - - - - - -
            Александр Бурдонский - внук
            Сталина сдал образец ДНК, и
            расшифровки показали, что его
            ДНК принадлежит к гаплогруппе G2.3. Это чисто еврейская гаплогруппа.

            0
            • offen
              10 февраля 2014  

              в молгене.ру посоветовали:

              Ваш гаплотип и есть якутский
              модальный гаплотип N1c1-M2019,
              причем без единой мутации в 17-ти локусах. Совпаденцы есть в базе данных YHRD http://www.yhrd.org/ . Только надо поменять порядок следования локусов
              (19, 389I, 389II, 390, 391, 392, 393, 385a,b, 438, 439, 437, 448, 456, 458, 635, GATA H4):
              14-14-32-23-11-16-14-11,13-11- 10-14-19-14-16-22-12

              0
              • nathan
                nathan
                Ветеран
                10 февраля 2014  

                Один в один как у топикстартера.

                0
              • nathan
                nathan
                Ветеран
                10 февраля 2014  

                Выдал карту с г.Якутском

                image

                0
                • offen
                  10 февраля 2014  

                  для чего эта карта?

                  0
                  • Не важно
                    10 февраля 2014  

                    У Натана этого добра хватает

                    А конкретные ссылки дать не может, интересно - почему?
                    Вот я прошу его дать ссылку о таблице про тунгусские С3, которые он мне привел, а он - молчит, отрывки подает, цыфры дает а ссылок - от куда он все это берет - нет. Или специально тянет с этим или переделывает там все в свою угоду??? )))

                    0
                  • nathan
                    nathan
                    Ветеран
                    10 февраля 2014  

                    Как для чего база данных

                    22 совпадений.Все в Якутии.

                    0
                    • Не важно
                      10 февраля 2014  

                      Ловкач! )))))

                      0
                    • Не важно
                      10 февраля 2014  

                      Старкластеры как раз есть Натан ))))

                      Лупа у тебя не та - посмотри хорошенько у Маньчжуров, Эвенков КНР и Хэчжэ (нанайцев) - там черно по белому написано СК с примечанием стар кластер.

                      Интересный такой гаплотипчик однако, изберательный - круто избирал себе стороны четко по границам, зарубежные тунгусы и Российские тунгусы.

                      Стало быть у зарубежных тунгусов С3* это уже стар кластер - а как Российские тунгусы уже не стар кластер. Интересный такой - умный такой гаплотипчик, хитрозделанный такой, еще так интересно влился в якутские гены в составе 2,1% ! Очень хитрый такой гаплотипчик - в прочем как и Натан! )))))))))

                      0
                      • Не важно
                        10 февраля 2014  

                        По таким данным получается что

                        Китайские тунгусы вливались в Якутские гены )))))) Так что ли???? ))))))))))) Нормальные люди к примеру так не напилися бы - что с одной стороны что с другой стороны - аж до полюса попутать! ))))))))))))))))))))

                        0
                        • Не важно
                          10 февраля 2014  

                          Ну если Натан настаивает на таком стечении обстоятельств -

                          То Саха с количеством 2,1% это и есть потомки Китайских тунгусов ))))))))))))))))) А еще на нас стрелки метаете - МаНьЧжРы, КиТаЙцЫ! ))))))))))))))))))) А как вы стали тюрками тогда с таким гаплотипом ??? )))))

                          0
            • nathan
              nathan
              Ветеран
              10 февраля 2014  

              Вот раздухарился, тунгус

              Напомни,кто там правил,и опылял вашу родину, при династии Юань.И заодно продекларируй выводы из этой работы)))

              0
              • Не важно
                10 февраля 2014  

                Так речь о том что мятежные чжурчжени перемешались с тюрками

                Хамаг Монголы с Йеко Монголами и стали просто Монголами - этого ты видеть не желаешь! Потому спор наш ни к чему не приведет.
                А Юани и нынче правят на рынке в Китае )))

                Лучше вспомни к кому обратились Монголы за помощью от Джунгар? )))

                0
                • Не важно
                  10 февраля 2014  

                  А заодно прежде чем роднится с Монголами

                  Призадумайся - с чего это предки Саха поменяли благополучный юг на север - где ничего небыло???

                  Северный отряд и всякая белеьердень не канает - тут нечего и некого заваеивать было! )))

                  Ведь возвеличивая своих гонителей Монголов если ты Саха - то ты плюешь в души своих далеких предков которые ушли от них - причем спасаясь. Ибо так далеко можно уйти только от полного истребления!

                  Это Монголы и никакого отношения они уже ни к тунгусам ни к якутам не имеют.

                  0
                • nathan
                  nathan
                  Ветеран
                  10 февраля 2014  

                  Не увилививай фарисей

                  Где старкластер эвенов?или ты не эвен.

                  0
                  • Не важно
                    10 февраля 2014  

                    А это ты у ученых спрашивай - почему это

                    у китайских тунгусов С3* это вдруг старкластеры а у российских тунгусов - в том числе и у эвенов С3* вдруг не старкластеры?!

                    Хитрый такой ген старкластер С3* - избирательный )))) Весь в тебя ))))

                    Пусть будет по твоему - саха в прошлом китайские это тунгусы! )

                    0
                    • nathan
                      nathan
                      Ветеран
                      10 февраля 2014  

                      Выглядит это как, финн пытается натянуть С3* якута, на себя через марийца)))

                      Еще раз спрашиваю, где старкластер эвена?

                      0
                      • Не важно
                        10 февраля 2014  

                        Так же и у тебя - все хитришь Фарисей и с большой буквы!

                        С3* 12,9% - это и есть эвенский старкластер. У эвенков 40%. У Нанайцев и Ульчей которые в Китае значатся как Хэчже, у них свыше 30%. Объясни мне - как это у Нанайцев - у одного народа два разных кластера получается - причем китайские Нанайцы это старкластеры а Российские Нанайцы это не сатаркластеры????

                        Все это пиндежь про старкластеры - для евриев подобно тебе и придумано - надо понимать что это простое определение по принадлежности иностранности. Так что рано радуешся Натан.

                        Если Китайские Эвенки старкластеры то Российские эвенки не стр кластеры - да пусть так.

                        0
                      • Не важно
                        10 февраля 2014  

                        И не старайся Натан )))

                        Меня все равно не убедишь своими доводами - тем более ты трижды схитрил в данном вопросе!

                        1) не до конца выложил про тунгуские гены.
                        2) Скрыл что у тунгусов имеется старкластер С3*
                        3) Теперь же давишь на эвенские старкластеры - избирательно хитришь!

                        Но все равно не убедишь - потму что если уж у Китайских тунгусов есть старкластеры значит и у наших тунгусов они есть - и это понятно и тебе - просто по блистать желаешь своей головой - ну блестай )

                        0
                        • nathan
                          nathan
                          Ветеран
                          10 февраля 2014  

                          Я тебе ща, картинку покажу

                          Думаю этого будет, достаточно чтоб понять ментал, Не важно)))
                          image

                          0
            • восва_я
              10 февраля 2014  

              писали что мать Сталина работала у еврея богатого и там понесла от него

              0
              • offen
                10 февраля 2014  

                в кои - веки попал в струю :-) восвая

                Александр Бурдонский - внук
                Сталина сдал образец ДНК, и
                расшифровки показали, что его
                ДНК принадлежит к гаплогруппе
                G2.3. Это чисто еврейская
                гаплогруппа.

                0
                • Не важно
                  10 февраля 2014  

                  Аллелуевы же евреями были

                  0
                  • offen
                    10 февраля 2014  

                    по женской линии Ү-хромосома не передаётся :-)

                    0
                    • Не важно
                      10 февраля 2014  

                      Ну ни мне объяснять тебе о мирской жизни людей :)

                      Сам все поймешь ))) Не зря наверно Сталин считал что его предали - и если он не вывел весь сор из своей избы то и нам в нем капатся - как думаешь? А как внуков лепили - тут и предсказатель не угадает ))) Значит Бурдонская изменяла Василию - потому еврейские преобладило )))))))).

                      0
                • восва_я
                  10 февраля 2014  

                  и чингизхан- тоже внук еврея..читайте щетильней

                  0
  • гыгы999
    10 февраля 2014  

    По гаплотипу ЧХ не все понятно.

    Цитата:
    По Клесову - nathan
    10.02.2014 (09:41) (188.244.185.97)    
    Эти стандартные 12 маркеров в правильном порядке следующие:
    DYS# 383 - 390 - 19 - 391 – 385a – 385b - 426 – 388 – 439 – 389-1 – 392 – 389-2

    Итак, гаплотип Чингиз-хана:
    13 – 25 – 16 – 10 – 12 – 13 – 11 – 14 – 10 – 13 – 11 - 29[/quote]
    . Итак, гаплотип Чизгиз-хана:

    [b]15 - 14 - 25 - 10 - 11 - 13 - 11 - 10 - 26
    [/b]

    [quote]
    [quote]Возвращаюсь к днк Чингисхана, который, согласно Family Tree DNA:
    DYS 393 390 391 425 426 434 435 436 437i 438 439 388 389i 389ii 392
    Alleles 13 25 10 12 11 11 11 12 8 10 10 14 10 26 11

    ...


    Re: Чингисхан - N?
    « Ответ #19 : 15 Июнь 2009, 23:19:10 »
    Кстати ув.asan-kaygy (в миру - Ж.Сабитов) совершенно обосновано указал на хорошо известный историкам факт, которые генетики-авторы известной статьи о гаплотипе Чингизхана (Zerjal et al.2003) полностью обошли вниманием. А именно:
    Цитировать

    В первую очередь мы хотели бы отметить, что высокий социальный статус человека в прошлом не гарантирует, что у него будет огромное количество потомков. Скорее наоборот, мы хотели бы сказать, что высокий социальный статус человека всегда говорит о том, что у него будет относительно малое количество потомков. Например, во времена образования казахского хана жили два чингизида Джанибек и Гирей (троюродные братья), кроме них жил аргынский бий Акжол. В итоге чингизидов, потомков Джанибека, у казахов несколько тысяч, Гирей не оставил потомков, а у Акжола около одного миллиона потомков. Также говоря о чингизидах надо отметить, что демографический взрыв среди них пришелся на 18-й век (до
    демографического взрыва были известны около 10-20 чингизидов, потомков Джанибека) и продолжился в 19-м веке, когда чингизиды утратили свой высокий социальный статус в Казахстане после реформ второй половины 19-го века. С 15-й по 17-й века количество казахских чингизидов ориентировочно не превышало 500 человек. При хане Ишиме было около 120 чингизидов. То же самое можно сказать про Монголию, где в 15-16 веках на всю Монголию был один чингизид, Даян-хан.
    Этим мы хотим сказать, что утверждение о том, что высокий социальный
    статус является причиной большого количества потомков изначально не
    верно, так как по теории Голдстоуна-Нефедова и предположениям
    Крадина количество элиты всегда ограничено и ее перепроизводство всегда идет к войнам, где излишняя элита уничтожается путем физического устранения. Динамика количества членов правящей элиты обычно имеет цикличный характер. Сначала происходит бурный рост количества представителей правящей династии, потом из-за перепроизводства элиты начинаются гражданские войны, которые приводят к тому, что либо уничтожается большая часть представителей правящей династии, либо государство распадается


    Эти сведения хорошо согласуются и с данными по истории Золотой Орды, например, обстоятельствами прихода к власти ханов Узбека, Джанибека, Бердибека и эпохой "великой замятни", во время которой вырезались целые отрасли чингизидов. Счет устраняемых конкурентов-чингизидов шел на сотни. То же самое было в Чагатайском улусе, где к середине 14 века уцелел один-единственный чагатаид Туглук-Тимур, и в Иране, где примерно к тому же времени Хулагиды-Ильханы уничтожили сами себя. Ну и конечно, династия Юань в Китае, из потомства которой уцелел только один Тогон-Тимур.

    Так что ассоциация "звезднообразного" центральноазиатского кластера hg C3 с потомством Чингиза преждевремена. [/quote]
    Как я понял в Монолии остался:
    Цитата:
    в 15-16 веках на всю Монголию был один чингизид, Даян-хан

    Значит по истечении 400 лет не известно, 100% ли потомки Даяна которые сдали свои данные на ДНК по ЧХ.

    0
    • Не важно
      10 февраля 2014  

      Потому говорю

      Когда найдут его самого - вот тогда и посмотрим - кто он был на самом деле.

      0