1 год на форуме Топ пользователь 5000 просмотров Все
Награды
1 год на форуме
1 год на форуме
Топ пользователь
Топ пользователь
5000 просмотров
5000 просмотров
Оказывается Чинигизхан из рода Йека-Монгал 2.
  21402
По моей вине топ переполнился, оказывается в Скрытый можно писать большие версии, а то у кого телефоны страдают от большой информации, самому тоже долго приходилось листать).
Прошу заходить сюда.

[Сообщение редактировалось]

Ответов 343 Написать ответ
  • гыгы999
    31 октября 2012  

    Тюркские кочевые народы.

    Цитата:
    УКАЗАТЕЛЬ

    названий тюркских кочевых народов, которые все происходят от потомства четырех сыновей Диб-Якуя 220

    Последний был сыном Абулджа-хана, сына пророка Ноя, – да |А 7б| будет мир ему! – который послал его, а также Кара-хана, Ор-хана, Гур-хана и Коз-хана в стороны: северную, северо-восточную и северо-западную. Вследствие того что сын Кара-хана, по имени Огуз, стал исповедовать единобожие и к нему присоединились некоторые [его] родственники, то стали две части [одного народа]. Объяснение всего этого последует [дальше], дабы [это] стало [всем] известно.

    Вторая ветвь Огуза, сына Кара-хана, – уже была упомянута, как и некоторых его родных братьев и двоюродных, которые присоединились к нему.

    Цитата:
    Абулджа-хана, сына пророка Ноя, – да |А 7б| будет мир ему! – который послал его, а также Кара-хана, Ор-хана, Гур-хана и Коз-хана в стороны: северную, северо-восточную и северо-западную.

    Абулджа-хан
    абылаа=
    1) заколдовывать, околдовывать; 2) перен. привораживать, очаровывать, пленять.
    Джа-дьа-окончание.
    Значит Абылдьа-хан сын пророка НОЯ.
    Диб-Якуй (ГРОЗНЫЙ)
    дибдий=
    1) производить громкий стук, громко стучать; ааны дибдийдилэр в дверь громко застучали; 2) грозно топать, кричать, набрасываться с бранью на кого-л.; атаҕынан дибдийэр он затопал ногами; миигин дибдийдэ он меня обругал.
    Кара-хан (Черный хан);
    Ор-хан (ӨР-Хан-Долгожитель);
    Гур-хана (Кур-Хан уволенный в запас, в любое время может мобилизоваться);
    Коз-хана (Хос-хан Соправитель)
    Цитата:
    северную, северо-восточную и северо-западную.

    Вот нас и направили в эти стороны.

    0
  • гыгы999
    31 октября 2012  

    Сырдык уверял, что в библии 70% собственных имен переводится сахалы.

    0
  • гыгы999
    31 октября 2012  

    Карта пути Карпини и Рубрука

    image

    0
    • Могул
      31 октября 2012  

      гыгы999

      Вот ты и нашел, хоть и долго водил нас за нос. Как то обыденно получилось. Этим и объясняется идентичность Эллэяды с Ветхим заветом.
      Отец Эллэя Карахаан (Татаар Тайма) оказывается есть сын Ноя! Для уточнения видимо будет нужен Сырдык. Поздравляю!

      0
      • хе-хе
        31 октября 2012  

        ребята! Веселитесь -просто ОТПАД!!-))

        1
        • Атас
          31 октября 2012  

          У меня два гостинца

          Первый для Могула. Я выяснил происхождение твоего предка Бордона. В документах 1635, 1644 года он оказывается числился кангаласским князем. Точно так же, как и вождь жарханцев Трека. Как мы все прекрасно знаем, в 1642 году было восстание саха против колонизаторов. Инициаторами выступили сыновья Тыгына: Бозеко, Чаллаайы, Усун Ойуун и пр. В начале восстания главные заговорщики "Тыгыновичи" заманили атамана Галкина с 8-ю казаками в юрту Бозеко и там их всех вырезали. По документам видно, что в юрте среди самых главных заговорщиков был и "кангаласский князец Бордон". После поражения восстания Чаллаайы, Бозеко, Усун Ойуун и пр. были замучены и повешены, а Бордон со своими людьми ушел на Вилюй. С тех пор его людей упоминают уже как "бордонских", его самого как "бордонского князца". Видать, отважный был муж.
          Насчет "БОРДОНА" и "БОЙДОНА". Историк С.И. Николаев выяснил, что когда казаки у него самого выясняли имя, то обычно пишут "БОЙДОН". А когда со слов других, то он "БОРДОН". Николаев подозревает, что он скорее всего был человеком косноязычным или картавым, т.е. не мог нормально выговорить звук "Р".
          Вывод, Могул является чистым кангаласцем по происхождению, его прадед был картавым и тем не менее, весьма лихим и удалым воякой, вождем и родоначальником.

          Второй гостинец у меня припасен для Никона. Он мне глубоко несимпатичен и тем не менее, я человек не гордый. За его лютую злобу и ненависть отвечаю щедрым подарком. В 1985 году вышла книга "Дохристианские личные имена народов Сев. Вост. Сибири". Там есть список из 5954 якутских имен 17-18 веков. Так вот, наши ученые якутоведы из ИГИ смогли расшифровать значение лишь только 1083 имен. Смысл остальных 4 тыс. оказались невыясненным. Очень сомневаюсь, что лингво-вандал Никон в курсе этого. Тут есть где развернуться его неуемной фантазии, бери не хочу. Для начала дам всего лишь несколько штук якутских имен (из центр. и вил. групп улусов) 17-18 века (если он управится, в запасе у меня их несколько тысяч). Это вам не имена почти тысячелетней давности, переданные уйгуро-китаеязычными монгольскими вельможами арабским историкам, и дошедшие до русского языка через европейские языки, а совсем свежие, притом чисто "САКСКИЕ" и двухвековой давности:

          Абдук, Абуга, Авык, Адукай, Адурай, Аиган, Аикуй, Айба, Акий, Аколчюр, Акон, Акузал, Акумак, Акутай, Акуян, Акчей, Акысал, Алгилсен, Алда, Алдах, Алкауль, Алланый, Алмуй, Алсий, Алтабыга, Алтанин, Алтуй, Алчагай, Алчанда, Амалук, Амдой, Амкуй, Амон, Амтукан, Амук, Амур, Амустай, Амыян, Ангуй, Андей, Анекон, Аника, Анкатон, Аниюй, Аргудак, Аргуней... (хватит, дошли только до половины "А" по списку)

          0
          • Никон
            31 октября 2012  

            Не люблю инородных которые лезут на сакское без спроса.

            Так что атас иди лесом.

            0
            • Атас
              31 октября 2012  

              Уоскуй эрэ

              Эн ыалдьа5ын дуу, тугуй? Эн манна ким киирэрин-тахсарын барытын быһаарар хаһаайын буолан хааллын дуо, эйигиттэн ыйытабыт дуо? Күллэримэ эрэ... Дьон тэптэрэн-батааскалаан биэрдэ5ин аайы өрө баран иһимэ.
              Уөхсэргин кыатана тус, мин эйигин уөхпэппин ээ. Уопсайынан, сымыйанан тылы "ырытыаҥ" иннинэ мун саатар орто оскуола тасымынан грамматиканы уерэт.

              0
              • Никон
                31 октября 2012  

                Төрөөбүт төрүт тылбын миигиттн ордук билэр баара саарбах.

                Үс да үрдүк үөрэхтэн үтүө буоларыҥ биллибэт.
                Атын омук аата сахалыыга тииһэ сылдьыма.

                0
                • Атас
                  31 октября 2012  

                  Тылы билэргин тугунан дакаастыыгын?

                  Ити курдук "ырытыыларгынан" дуо?
                  Уопсайынан, этиһэн бүтүөх. Эн куһуҥ-хааһыҥ лахсыырын мин истибэппин, аахпаппын,оттон эн мин "атын омук аатын сахалыыга тииһэрбин" аа5ыма, үөхсүмэ. Мин эйигин саха тылын туругурда сылдьар киһи дии санаабаппын, саныам да суо5а. Ону атыннык туругурдаллар.

                  0
          • мин
            31 октября 2012  

            я попробую)

            Абдук – Өбдүк, Абуга – Өбүгэ или Абаҕа, Авык - Абык, Адукай - Өдүкэй, Адурай - Өдүрэй, Аиган - Өйүгэн, Аикуй - Өөкөй, Айба - Аайба, Акий - Аакай, Аколчюр - Өкөччер, Акон - Өкүөн, Акузал - Өкүһэр, Акумак- Өкүмэк, Акутай-Өкүтэй, Акуян - Өкүйээн, Акчей-Өкчөй, Акысал - Акыьал, Алгилсен-?, Алда - Алта, Алдах - Алтах, Алкауль -?, Алланый - Аллаанай, Алмуй - Өлмуй, Алсий - Өлсөй, Алтабыга - Алтабуҕа, Алтанин - Алтанньа, Алтуй-Алтай, Алчагай-Аччаҕар, Алчанда-Алчаҥда, Амалук-Амалык, Амдой- Амдай, Амкуй- Амкыай, Амон-Аман, Амтукан-Өмтүкээй, Амук-Аамык, Амур-Амыр, Амустай-Амыстай, Амыян-Амыйаан, Ангуй-Аҥкый, Андей-Өндөй, Анекон-Ааныкан, Аника-Ааныка, Анкатон-Аҥхаатай, Аниюй-Анньыай, Аргудак-Аргыдах, Аргуней-Өргөдей...
            Атас, эн Ньыыканы булума эрэ) Эн тэннээгин буолбатах. Уерэҕэ хаара суох кеннеру саха уиьитэ. Эн анал тыл уерэхтээх улахан киьи, саха да буолбатаргын) Уерэхтээх сахалар тылларын атын омук ненуе билэллэрин себулууллэр) Онон эн септеех миэстэҕэр сылдьаҕын. Саха буолбатах эрээри сахалны сахалыыга уерэтэҕин)

            0
            • Никон
              31 октября 2012  

              Бэрт-бэрт.

              Бу сахалыы тыыппалаах киһи эбит.
              Аны маны билэргин нууччалыы тылбааһын ууран биэр.
              Холобур.
              Абый, Абала = овуля = названия биочасов и календаря организма мужика и бабы. Абый = биочасы у бабы, через которые месячные отсчитываются по луне. Абала = биочасы мужика, через которые сперма произрастает по солнцу в утро каждого 73-го на 74-й день в мошонке. В честь них и есть имена Абый, Абала.
              И так дальше и все будет о кей.

              0
              • Кулумнуур
                1 ноября 2012  

                никон овуляция диэн латинскай тыл

                нуучча тыла буолбатах.
                эн этэргинэн латинскай тыл минусовой тыл, мантан сылтатан эттэххэ таах салгыны тасыйа сылдьа5ын. хайдах ба5арбаккын туойа сылдьа5ын.

                0
            • гыгы999
              31 октября 2012  

              "Мин" сөпкө суруйбуккун)))красава, целые лингвоинституты отдыхают)))

              МНОГОУВАЖАЕМОГО НИКОНА НЕ ТРОЖТЕ, ПУСТЬ КОГДА ЗАХОЧЕТ ЗАХОДИТ, КОГДА НЕ ЗАХОЧЕТ НЕ ПИШЕТ, ЕГО ДЕЛО. ОН СПЕЦ ПО ЯЗЫКУ САХА И ЭТИМ ВСЕ СКАЗАНО.

              0
            • 1
              31 октября 2012  

              Оо, ол хаьаахтар суруйбуттара диэн)

              Мунньан диэни мунячко энин диэн дьаабылыы сылльар дьоннор)
              Тыгын диэни тынин
              Ити "мин" диэн киьи наьаа кенетунэн сахатыта сатаабыт да уонна бээтэ тугу да ейдеебетех. Хайыаный, мас хайдыбытынан кене киьини)
              Абдук ба5ар Бугдук буолуо, ба5ар Дабдык буолуо) Суор Бугдук 16-17 уйэтээ5и киьи, Кутур эмээхин улахан уола, холобур.
              Амон диэн букатын фараоннар ааттара дии)))
              Амкуй диэн бука Омукай игин буолуо, били терутун аатынан. Таатта5а Кулаковскай ебугэтэ Омучча диэн ойууну куустэринэн сурэхтээн Аммос буолбут диэн баара)
              Чэ ити курдук
              Хата теманы мээнэ халыппакка 12-13 уйэтээ5и монголлары ырытыахха баара. Бары да сурукка-номоххо киирбит дьоннор

              0
          • offen
            31 октября 2012  

            Атас, көр эрэ Абый диэн ааты

            Абый диэн аат Мэҥэттэн ыраах Абый улууһугар тарҕаммыт аат

            0
            • Атас
              31 октября 2012  

              испииһэккэ оннук аат суох

              Киллэрбэтэхтэр.
              Мин "сахатыппыккын" эрээри, туох суолталаахтарын то5о ырыппакыный? Этэбин ээ, ону манна баар дьонтон биир эрэ киһи "кыайар" буолуохтаах. Кимин билэ5ит.

              0
              • offen
                31 октября 2012  

                абый – брат, старший брат, старший дядя, уважительное обращение татар, башкир, чувашей к дяде

                Абый - дядя (абаҕа) Тыгын Дархана

                0
                • 1
                  31 октября 2012  

                  Абый диэн абытай кылгатыллыбыта

                  Хообур Абый Бааска)
                  Абый киьи ээккин батта)

                  0
                • Никон
                  31 октября 2012  

                  Син сөп Оффен.

                  Убай диэн тыл Абый диэнтэн ылыллыбыт.
                  Абый Ийэ иһинээҕи чаһыы. Ким эрдэ төрүүрү абый быһаарар.
                  Аҕа буоллаҕына - убай, балыс буоллаҕына - быраат.
                  Наадыйдаххытына син сөпкө туһумурдуугут ээ.
                  Нуучча үөрэҕэ баһыйбыта бэрт.
                  Толкуйу мэһэйдиир.

                  0
              • Gunn
                31 октября 2012  

                Насколько я сведущ в сакском языке

                Мне удается понять смысл многих имен собственных из перечисленных. Однако, имена у якутов даются несколько иначе чем у другиХ народов. Если другие народа дают имена в честь богов и иных способов у якутов имена даются по анатомоморфологическим, псиХическим и другим подобным признакам. Вообще всякое сакское слово содержит в себе не только грамматику, но и определенный смысл, часто сакральный. В этом отличие сакского языка отдругих. Например, ваш ник Атас кроме написания и распространенного смысла типа друга имеет менее известный смысл - меняла. Якуты атасом называют человека с которым когда то вступали в экономические отношения под названием мена. Никон безусловно занимает особое место в толковании сакских слов. Этого нельзя отрицать. Вам не следует на него обижаться. Тем более вы тут новенький, а Никон чуть ли с самого основания форума. Вы вобщем ортодоксальный филолог, а он основатель общепризнанного в форуме нового направления знаний - СаХ Сакрала. Тут были ортодоксы похлеще вас, но теперь они где и где Никон:)

                0
          • Могул
            31 октября 2012  

            Атас

            Атас, спасибо за старание! Но меня очень смутило одно обстоятельство. Из Вашего текста понял, что Тыгыновичи и Бордон заманили атамана Галкина с 8 - ю казаками и их всех вырезали. Так? Но как же потом этот убитый атаман в своей челобитной сообщает, что у них убиты только двое, а сам он жив и здоров, хотя и получил 5-6 ран? Я это читал напечатанную в том виде, как было написано самим атаманом.

            0
        • Могул
          31 октября 2012  

          Хе хе

          Веселье тупым, раздумье умным...

          0
      • гыгы999
        31 октября 2012  

        Махтал Могул- Рашид ад Дин записал это со слов наших предков в XIII в.

        Значит Эллэй от ветви Огузов пошел.

        0
        • Никон
          31 октября 2012  

          Эллэй Ох-уус буолбатах.

          Эллэй Татаар Тайма тохсус уола.
          Дьиҥнээх саха.
          Тайма Татаар сиэннэрэ буолабыт онон билэбит итини.

          0
          • 1
            31 октября 2012  

            Хайдах эмиэ да татаар, эмиэ да саха)

            Туоттаах ол хантан эрэ кэлбит киьиэхэ сигэнэн хааллыгыт.
            Онноо5ор сакыраалларын ийэтэ-а5ата)))
            Эллэй диэн эллиин буо, ханнык эрэ терут да грек буолуо)
            Омукай диэн аатыгар олорор - омук)
            Биьи хантан да кэлбэтэхпит
            Манна теруу баар ыал о5олоробут!)

            0
            • Gunn
              31 октября 2012  

              Татаар диэн омук суоХ.

              Тат Аар диэн тыл аата. Билигин балыйан туур тыла дииллэр. Татаар тыллаах таба эппэтин диэн уьу домох эрэ хаала сылдьар.

              0
            • Никон
              31 октября 2012  

              Саха тылын дьиҥнээх аата Татаар тыла диэн.

              Саха тыла = начальный язык диэн утары тылбааһа.
              Татаар тыла = Аар Тат Ай диэн таҥара биэрбит тыла.
              "Татаар тыллаах таба эппэтин" диэн алгвска туттааччылар.
              Тылы харыстаан тута сылдьар киһи былыр татаар диэн ааттанара.
              Татаар омук буолбатах. Ити кэлин омуктар буккуллан түүркүйэ
              саҕана татаар тыллаах татаардарбыт диэн ааттаммыттара.
              Билиҥҥи татаардар омуктарын аата булгаар диэн.
              Булгунньах оҕолоро (курганная цивилизация диэн баара).
              Ол булгунньах Хаспах муоратын таһыгар баар.
              Хаспах муоратын тардыыыта. Бэрт киэҥ сир.
              Булҕа (Волга) диэн өрүстээх.
              Ити булгунньах өрүһэ. Ол иһин булгунньахтан таҥнары сүүрдэн түһэр.
              Хаспах муоратыгар. Хотуттан - соҕуруу сүүрдэр.
              Дьиҥнээх өрүстэр бары соҕурууттан - хоту сүүрдэллэр.
              Ити бэрт киэҥ иэннээх булгунньахха олорбут дьон бары булгаардарбыт дэнэр буолбуттара. Элбэх биис ууһа олорбута.
              Саамай сүрүн биистэрин аата Саар Сах Сармаат диэн саха биис ууһа этэ.
              Төрүт киһилэрэ Сах Саар Тойон эмээхсинэ Сабыйа-баай хотун диэн.
              Үрүҥ Уолан диэн уоллаахтар үһү былыр. Бухатыыр киһи.
              Туйаарыма-куо диэн кийииттээхтэрэ үһү.
              Олору Үс Саха бырааттылартан улаханнарын Уран-хаан уонна Арылы-куо
              уола дуу, сиэнэ дуу Ньургун-боотур диэн босхо бөлөҕөс саҕа бухатыыр
              көмүскүүрүн туһунан олоҥхоҕо элбэх кэпсэнэр.
              Онон Саар Сах сармааттар Үс Сахаттан биир салаалара буолаллар.

              0
          • Атас
            31 октября 2012  

            Могулу

            Наверное, их "у нас" было двое. Скорее всего, братья. Убитого в 1642 г. звали вроде Осип Галкин, второй, кажется, Иван. Или ошибаюсь. Кстати, в юрте у Бозеко были не только тыгыновичи и Бордон, но и лихие мальжагарские, нерюктяйские вожди. А то что казаки потом отчитались о только двух убитых, это на их совести. В русско-российской бюрократии испокон веков так принято. Я написал это исходя, в основном, из якутских преданий.

            0
            • Могул
              31 октября 2012  

              Атас

              У Вас, Атас, очень интересные данные! Меня лично заинтересовало огромное количество имен. И, на мой взгляд, наши сакралы очень верно передали смысл некоторых имен. И также эти имена кажутся, на мой взгляд, при первом прочтении, не якутскими. Они скорее всего кажутся монгольскими. Значит можно сделать вывод, что практически все имена предков Чингисхана есть якутские. Тем более там есть имена чисто якутские в смысле современного произношения! Один пример, это кличка коня принадлежавшего почти что первопредку ЧХ, - ДАЙАР. А смысл этого слова знает каждый якут.

              0
  • Атас
    31 октября 2012  

    гунну

    Вы вобщем ортодоксальный филолог, а он основатель общепризнанного в форуме нового направления знаний - СаХ Сакрала. Тут были ортодоксы похлеще вас, но теперь они где и где Никон:)

    В том что тут Никон выживает "филологов-ортодоксов" "похлеще меня" не вижу повода для радости. Поэтому, наверное, не заглядывают настоящие историки и филологи. Исторические форумы некоторых братских республик напоминают кладезь мудрости, в них бывает столько полезного. А наш форум, прошу прощения...
    Кстати, не такой уж я и новичок. Я помню, как Никоны с таким шумом, хамством и сквернословием выживали некоего компетентного товарища (ник был бастакы аахпыт или что-то в этом роде)

    0
    • Gunn
      31 октября 2012  

      Никон вроде выживанием ников не занимается:)

      У людей Заканчиваются аргументы и они исчеЗают)

      0
      • Оidоv
        31 октября 2012  

        Думаю не правы , изчезают , по другой причине . Как и появляются новые .

        Можно ли быть докой , во всех вопросах по " происхождению саха или " рода " матери ЧХана ? Это только "автохтоны" , со своим черепом и " неолитом " щеголяют - спор для "дураков ". Вместо того : автохтонтов - автохтонтам . " южанам " - последовательность прихода племен " каравана " саха : хунну , " древние саха " , хоро , тумат , ураанхай саха - после конфликта с чингизидами . И где , была , их родина ??? Первая родина , - по Олонхо .

        0
        • Оidоv
          31 октября 2012  

          Напишу по памяти о Баргуджин Токума - Баргу дьи5 . Вероятно , настоящие БАРГУт .

          Лесные урянкаты , (ак , кол ? Не помню ) там где обитают кори , баргут , тумат , они близки друг к другу , не есть коренные монголы , другие . Притязают в разжигании 70и очагов ЭРГУНЭ КУНа .- Рашид Ад Дин . А теперь сравните с Олонхо .

          0
          • Оidоv
            31 октября 2012  

            Опять сепораторы банят , почему баните ?

            0
            • Оidоv
              31 октября 2012  

              Не пропускаете родословную ЧХана ?

              Потому что , имена урянхай и ураанхай ?

              0
    • БастакыАахпыт
      31 октября 2012  

      Спасибо, что помните, Атас:))

      Но малюсенькое уточнение: меня никто отсюда не "выжил".
      Мавр сделал своё дело, мавр должен уходит. Я, как думаю, здесь своё дело сделал.
      И теперь больше занят другим не менее важным делом, как никак являюсь редактором по художественной литературе самой многотиражной (свыше 33 тыс. экз.) сахаязычной газеты "Кыым" и главным редактором самого многотиражного (примерно 14 тыс. экз.) литературно-публицистического альманаха республики "Кюрюлгэн", членом правления Союза писателей РС (Я).
      Так что работы непочатый край:)) Тем более и в газете, и в альманахе публикуем исторические и языковедческие материалы, причём "Кюрюлгэн" относится к категории государственных СМИ.
      В принципе, если кто решится, возможно сотрудничество с форумными историками. Объём альманаха (128 стр. формата А4) позволяет публиковать даже романы:)) Заодно обеспечим рекламу, пиар «Исторического форума» Якт.ру:) При этом авторам платим гонорар.
      Электронная почта редакции: kyrylgen@inbox.ru
      Кстати, несколько раз сахаральщикам предлагал опубликовать свои опусы, но они не решились:)) Кишка, видимо, тонка:))
      Вы уж моё письмо не поймите превратно, я тут никогда не скрывал себя, поэтому пишу открытым текстом.
      С уважением А.Г. Гуринов-Арчылан.

      0
      • Могул
        1 ноября 2012  

        БастакыАахпыт

        Многоуважаемый А. Г. Гуринов Арчылан! Я хоть и включился позже (технические причины) со своей стороны выражаю полное согласие. Тем более в свое время были напечатаны на две полных страницы моя статья под названием "Стратегия уонна тактика дьүөрэлэспэтэхтэринэ...". А также интервью по части педагогики относительно развития памяти и языка преподавания. Эти статьи у некоторых вызвали горячий интерес, за что очень благодарен газете "Кыым"!
        И я относительно вашего желания хочу сказать следующее, с чем многие будут согласны (так думаю). Автор должен свою статью (в виде проекта) напечатать здесь, разумеется с приведением ссылок на те или иные тексты форумчан. Если автор будет согласен, то так и ответит, а может, и исправит кое что. Так что думаю, что идея стоящая. Желаю успеха!

        0
        • БастакыАахпыт
          1 ноября 2012  

          Спасибо, Могул

          Вам также желаю успеха. Вашу статью прочитал с большим интересом. Такие публицистические статьи и сейчас очень нужны. Тем более 2013 год у нас в республике объявлен Годом развития села.

          0
      • ;))
        1 ноября 2012  

        Иди накуй, стукач:)

        Оборотень, под атаса косишь:))

        0
        • БастакыАахпыт
          1 ноября 2012  

          А ты, дорогуша, под кого косишь?:))

          Цитата:
          Проекция в психологии, восприятие собственных психических процессов как свойств внешнего объекта в результате бессознательного перенесения на него своих внутренних импульсов и чувств.

          Так пишут специалисты. А народ это явление выразил по своему очень метко: обычно вор громче всех кричит "Держите вора!":)) От себя тут добавлю: особенно старается мелкий воришка:))

          0
      • 1
        1 ноября 2012  

        А.Г. Гуринов-Арчылан неужели принимаете всурьез сакыральщиков и лично Тумус Мэхэлэ с его похабными

        "работами"?)))

        0
        • БастакыАахпыт
          1 ноября 2012  

          Извините, прошу уточнить вопрос

          Что имеете в виду спрашивая, "неужели принимаете всурьез"? То, что готов опубликовать опусы сакыральщиков? Или что другое?

          0
          • !!
            1 ноября 2012  

            Не прикидывайся, артист:)

            Сам с собой разговариваешь?;-)

            0
            • БастакыАахпыт
              1 ноября 2012  

              Настоятельно советую ещё раз прочитать:))

              Цитата:
              Проекция в психологии, восприятие собственных психических процессов как свойств внешнего объекта в результате бессознательного перенесения на него своих внутренних импульсов и чувств.

              0
          • 1
            1 ноября 2012  

            Бэт былдьаьа5ын дии

            Хотя доли правды есть и в никоновских взглядах)
            Например, если исходит от булгарских летописей.

            0
            • БастакыАахпыт
              1 ноября 2012  

              Не обессудь, Однёрка:))

              Каждый думает по мере своей испорченности:))
              Ещё, мухи всегда необходимо отделять от котлет. То есть, нужно придерживаться темы обсуждения. Причём тут "бэт былдьаһыы"? Кстати, правильно нужно писать "бэрт":)) Так и не уточнили свой вопрос:))
              Доля правда, даже своя бАльшая правда, есть везде. Проблема в содержании и качестве правды, а именно в созвучии конкретной правды с правдой других:))
              Напишите обоснованную статью про булгарские летописи, напечатаю в "Кюрюлгэне". Это будет намного сильнее и эффективнее чем умничать и впустую стараться подкалывать меня здесь, этим поможете поднять посещаемость форума, значит и свою популярность:))

              0
              • БастакыАахпыт
                2 ноября 2012  

                Работа над ошибками:))

                Оказывается, вместо "Доля правды..." написал "Доля правда...". Зажмурился, видать:))
                И наверху в предложении "Мавр сделал своё дело -- мавр должен уходить" мягкий знак не поставил. Вообще, как толкуют, правильный шиллеровский вариант афоризма не "... должен уходить", а "может уходить". Именно "может уходить":)) Значит, мавр может приходить и работать над ошибками:)) Что мавр и сделал:))

                0
  • Мо5ул
    1 ноября 2012  

    Оказывается...

    Бэйи эрэ до5оттор! ЭЬиги эр дьон буоллаххытына дьыала5ытын утары корсон быЬаарсыҥ! Эфири киртитимэҥ!! Аан дойду көрөр!

    0
  • прохожий
    1 ноября 2012  

    да это у них норма)

    Как только появляется этот субчик-Арчылан форум превращается в помойку:( К сожалению, семья свегда не без ***)

    0
    • БастакыАахпыт
      1 ноября 2012  

      Ваши слова яркая иллюстрация ущербного мышления:))

      Исторический форум для вас - помойка. Значит, форумчане кто? Я понятно, "субчик", "***". А ты кто?:))

      0
  • 1
    1 ноября 2012  

    Тюркское племя май (микен, магун, мэн) - отсюда и мегинцы, моголы?)

    Древние писатели среди этих племен единодушно выделяют индоарийские племена барынджар, шуд и тэки, тюркское племя май (микен, магун, мэн) и другие
    http://s155239215.onlinehome.us/turkic/10_History/Djagfar_Tarihi/Contents_DjagfarTarihi_Ru.htm

    0
    • Могул
      1 ноября 2012  

      1

      Хотя и поверхностно, просмотрел. Меня заинтересовало имя царя булгар АЙДАР (815-855гг), который согласно по данному источнику основал город КИЕВ. К тому же он назывался еще УРУС АЙДАР (Могучий Айдар). Тогда получается, что УРУСЫ вообще не норманны, а действительно имеют тюркские корни(например, здесь говорили УРУС ЙЕКА МОНГАЛ) . Может быть есть где другие источники созвучные данному.
      Также имеется их предок САКУЛ, и МАН ГУЛ?! НО, кажется все перепутали эти исламские имена. Также весьма интересно, что их ТАНГРА имеет основу АР!

      0
  • гыгы999
    1 ноября 2012  

    Могул кажется то,что я выставлял действительно мало кто читает)

    Цитата:
    Рашид ад Дин - гыгы999
    29.10.2012 (17:59) (95.165.120.164)    
    ОТНОСИТЕЛЬНО ИСТОРИИ И НАРОДНЫХ РАССКАЗОВ ОБ ОГУЗЕ И ДВАДЦАТИ ЧЕТЫРЕХ ВЫШЕУПОМЯНУТЫХ ПЛЕМЕНАХ, ПРОИСШЕДШИХ ОТ ЕГО ПОТОМКОВ И ОТ НЕКОТОРЫХ ЕГО РОДНЫХ И ДВОЮРОДНЫХ БРАТЬЕВ, ПРИСОЕДИНИВШИХСЯ К НЕМУ. ОТ [ВСЕХ] ИХ ПРОИЗОШЛИ ПЛЕМЕНА: УЙГУРЫ, КИПЧАКИ, КАНЛЫ, КАРЛУКИ И КАЛАЧИ. [ВСЕ ЭТО ИЗЛАГАЕТСЯ] СОГЛАСНО ТОМУ, ЧТО СООБЩАЮТ МУДРЫЕ ЛЮДИ [ЭТИХ НАРОДОВ] И НА ЧЕМ ВСЕ ОНИ СХОДЯТСЯ

    На основании того, что упомянуто в мусульманской истории и записано в «Пятикнижии» еврейского народа, пророк Ной [Нух] – да будет мир ему! – разделил землю с севера на юг на три части. Первую часть он дал одному из своих сыновей, Хаму, который был родоначальником чернокожих; вторую – Симу (Сам), ставшему предком арабов и персов; третью часть предоставил Яфету (Яфес) – праотцу тюрков. [Ной] послал Яфета на восток. Монголы и тюрки рассказывают об этом то же самое, но тюрки назвали и продолжают называть Яфета Булджа-ханом [Абулджа-ханом] и достоверно не знают, был ли этот Булджа-хан [Абулджа-хан] сыном Ноя или его внуком; но все они сходятся на том, что он был из его рода и близок к нему по времени. Все монголы, племена тюрков и все кочевники [букв.: обитатели степей] происходят от его рода. Подробности этого обстоятельства они передают в следующем виде.

    Булджа-хан [Абулджа-хан] был кочевник; его летовка была в Ортаке и Казтаке, которые представляют собою чрезвычайно большие и высокие горы; в тех пределах находился город по имени Инандж 276. Зимнее стойбище Булджа-хана [Абулджа] было также в этих пределах, в местностях, называемых Бурсун 277, Какьян и Каркорум 278, [81] называют также [его и] Каракорум. Поблизости этих мест находятся города Талас 279 и Кары-Сайрам 280.

    Манна Абулджа-хан Булджа-хан буолан сөп.
    Булдьа-Быльдаа (отнимающий, но скорее всего завоевывающий)хан.
    Цитата:
    Последний город – древний и необычайно большой. Видевшие этот город передают, что от начала его до конца – один день пути и что в нем сорок ворот. В настоящее время там обитают тюрки-мусульмане. Он находится в зависимости от Кайду 281, [причисляясь] к улусам Кунджи 282. Местность, которую занимают его потомки, находится поблизости. У Булджа [Абулджа-хана] был сын по имени Диб-Якуй [Диб-Бакуй]; слово «диб» имеет значение диспута 283 или место должности, а слово «якуй» означает [человека], властвующего над всеми племенами. Этот сын превзошел своего отца как могуществом, так и |А 9а| [всеми] доказательствами [своего] царственного достоинства. Он имел четырех сыновей с такими именами: Кара-хан, Op-хан, Коз-хан и Гур-хан. Весь этот народ был неверным. Кара-хан стал преемником отца; у него родился сын, который трое суток не брал материнской груди и не пил [ее] молока; по этой причине мать его плакала и молилась. Каждую ночь она видела во сне, будто бы ребенок ей говорил: «Мать моя! если ты станешь поклоняться [истинному] богу и возлюбишь его, я стану пить твое молоко».

    Цитата:
    Вследствие того, что ее муж [Кара-хан] и весь их народ были неверными, та женщина опасалась, что если узнают о почитании ею [единого] бога, то ее убьют вместе с ребенком. Она тайно приняла исповедание истинной веры и с совершеннейшей искренностью стала любящим другом [всевышней] истины, – да будет она прославлена и превознесена! И младенец взял материнскую грудь и стал сосать молоко. В возрасте одного года он был необычайно опрятный и красивый ребенок, на челе которого блистали признаки зрелого ума и руководительства в путях истинной веры. Тогда его отец [Кара-хан], видя в нем эти признаки, сказал: «Не рождалось в нашем народе ни одного дитяти с такой внешностью и с таким лицом; этот [мой] сын сделается наиболее великим и уважаемым из среды равных и подобных себе и, пожалуй, достигнет степеней совершенства».

    По поводу наречения имени ребенку отец устроил со своими сородичами совещание, а то годовалое дитя, заговорив, сказало: «Назовите меня Огузом». Все присутствующие были чрезвычайно поражены этим обстоятельством. Они назвали младенца именем Огуз, согласно его словам, которые были несомненным признаком руководительства всевышней истины.

    Раньше я читал про Огузов, но как интепретировали историки, тоже считал, что это от слова Оҕус (Бык), на самом деле такое имя превращает любое племя из кочевников в полукочевников-полуземледельцев.
    Но вот Никон назвал истинное имя Ох Уус и сразу все стало на свои места.
    ох
    1) стрела;
    I мастер; II 1) род, семейство; аҕа ууһа род (букв. отцовский род); ийэ ууһа семейство (букв. материнский род—ряд поколений, происходящих от одного предка); 2) биол. вид.
    ОХУУС-ПЛЕМЯ ЛУЧНИКОВ. ПЛЕМЯ ИСТИННЫХ ЛУЧНИКОВ-КОЧЕВНИКОВ НА КОНЯХ.
    НАСЧЕТ ЕДИНОВЕРИЯ РАШИД АД ДИН КАЖЕТСЯ НЕ ЗНАЛ ПРО ТАҥАРА ИЛИ КАК ОМУСУЛЬМАНЕННЫЙ ЕВРЕЙ СОЗНАТЕЛЬНО ИСКАЗИЛ ИСТОРИЮ.

    0
    • гыгы999
      1 ноября 2012  

      Уус-

      I мастер; II 1) род, семейство; аҕа ууһа род (букв. отцовский род); ийэ ууһа семейство (букв. материнский род—ряд поколений, происходящих от одного предка); 2) биол. вид.

      0
  • гыгы999
    1 ноября 2012  

    Каракорум-я думаю правильней название Кэрэ Көрөм (Увидеть прекрасное)

    Скрытый текст
    В начале ХХ века ученые определили местонахождение столицы Чингисхана в верховьях реки Орхон в центре Монголии. Первоначально здесь находилась кочующая ставка монголов и только в 1219 г. был основан город. В китайских летописях описывается золотой шатер Чингисхана, большая юрта, вмещавшая несколько сот человек. Столбы и порог в ней были обернуты золотом, поэтому ей и было присвоено название «Золотой шатер». Одно из первых описаний кочующей ставки Чингисхана на берегах Орхона принадлежит даоскому монаху Чан Чуню, который сообщает, что стан кочевников состоит из многих сотен войлочных шатров, паланкинов и «палаток», более или менее постоянных.Кочевая империя из юрт, с временными ставками, традиционно перемещающимися по стране с места на место, в зависимости от состояния пастбищ и источников воды, создала только один, известный из исторических описаний, город в Монголии – «город драгоценностей» Каракорум. По свидетельству летописцев, в эту монгольскую столицу с большим количеством каменных зданий и церквей, в период расцвета Монгольской империи стекалась богатая военная добыча и дань, золотые и серебряные изделия со всего мира, в летописях упоминаются о подношениях 30 тыс. серебряных слитков за один раз. В Каракорум непрерывно, в течение нескольких десятилетий, шли караваны с богатыми военными трофеями, доставлялись с захваченных земель лучшие ремесленники для ведения строительных работ в городе. В китайской летописи Ган-му в записи 1251 г. есть упоминание об отпущенных (обратно в Китай) 1500 человек, участвующих в постройке города Каракорума. В исторических хрониках говорится, что ежедневно в город приходило до 500 верблюдов, груженных продуктами и товарами. Город Великого хана отличался роскошью дворцов и каменных строений, соперничающих по своей красоте с самыми богатыми городами мира. Его даже сравнивали с Багдадом. И было бы логичным предположить, что при раскопках этого города будут найдены следы его былого богатства и величия.
    Раскопки предполагаемого Каракорума проводились в 1948–1949 гг. советско-монгольской археологической экспедиции и возобновились в 1999 г. совместной экспедицией немецкого Археологического института, университета Бонна и Монгольской академии наук. Никаких сенсаций археологи не обнаружили. Все найденное типично для любого средневекового города. Никаких сокровищ и каких-либо надписей с именами Чингисхан, Угэдэй или Каракорум найти не удалось. Удивителен сам факт, что от величественного города не сохранилось никаких развалин. На его месте сейчас ровное поле с травами, хотя все известные в мире столицы оставили потомкам зримые следы своего процветания в виде остатков каменных стен и фундаментов. Развалины уйгурской столицы Хара-Балгасун (IX в.), расположенной севернее монастыря Эрдэнэ-Дзу, сохранились лучше и выглядят достойнее, чем найденные фрагменты фундаментов отдельных зданий города с китайским названием Та-хо-линь, отождествляемого ныне с мифическим Каракорумом.
    Что скрыто под полутора метровым слоем земли еще предстоит выяснить археологам. За время немецких раскопок (1999–2004 гг.) был частично раскопан фундамент строения, отождествляемого с дворцом Угэдэя, размеры которого оказались значительно меньше, чем было известно из описаний очевидцев. Тем не менее, археологи, ведущие раскопки храма, продолжают утверждать, что этот фундамент как раз и является основанием дворца Угэдэя, который подробно описал Гильом де Рубрук.
    В 2001 г. турецкие археологи в бассейне Онона во время раскопок нашли около 1500 предметов, среди которых золотая корона с орлом и женское украшение, богато украшенное драгоценными камнями. Все эти находки относятся к тюркскому времени. Монголо-немецкая археологическая экспедиция в Каракоруме раскопала каменные опоры храма Угэдэя и каменную мостовую, а в 2002 г. обнаружила печать 1371 г. с уйгурским текстом и большое количество китайских вещей.
    При раскопках города, еще в 1948 г. были найдены надписи «Та-хо-линь» (китайское название города) и персидские надписи «Шэхръ Ханбалыкъ» (персидское название города). Эти названия были отождествлены Н. Ядринцевым как название столицы монголов – Каракорум. На основании этих надписей на камнях, обнаруженных на территории монастыря Эрдэнэ-Дзу, появилась мировая сенсация об обнаружении столицы Чингисхана. Затем была найдена каменная стела с двуязычной надписью на китайском и монгольском языках, где кратко излагалась история монгольской столицы. По мнению ученых, стела была установлена в ознаменование четырехлетней перестройки Каракорума в 1342–1346 гг. Перевод надписи, выполненный учеными, на каменной стеле, гласит: «Каракорум («Та-хо-линь») – место, откуда началась династия Юань». Китайские иероглифы «Та-хо-линь» перевели, как Каракорум. Столицу Великой монгольской империи было нужно найти в Монголии, и ее нашли. Так монгольский Холинь, был официально признан легендарным Каракорумом.После падения империи Юань, в 1380 г. город был до основания разрушен китайскими войсками. От былого величия до наших дней сохранились только каменные черепахи – постаменты для каменных стел, на которых высекались важнейшие указы центральной власти. По преданию, город охраняли от наводнений 4 гранитных черепахи. Две каменные черепахи, находятся в настоящее время вблизи монастыря Эрдэнэ-Дзу. Одну каменную черепаху можно увидеть у стен монастыря Эрдэнэ-Дзу с его северо-западной стороны, другую недалеко в горах, на юго-востоке. Подобные каменные черепахи, как символ мудрости, известны также в Китае.
    Впервые предположение, что следы строений, обнаруженных на месте современного Хархорина на Орхоне, могут быть столицей чингизидов – городом Каракорумом, было высказано руководителем экспедиции Восточно-Сибирского отдела Русского географического общества Н.Я. Ядренцевым в 1889 г. В своих дневниках Н.Я. Ядренцев записал: «Мы нашли громадные развалины, к которым нестыдно приурочить и город драгоценностей (Каракорум)». Это были первые и единственные найденные развалины в верховьях реки Орхон. Они и стали в последующем отождествляться с Каракорумом (основан в 1219 г., завершено строительство в 1235 г., в 1380 г. Каракорум разрушен китайскими войсками). С 1263 г. столицей Монгольской империи был провозглашен Пекин и монгольская столица была перенесена из Каракорума в Пекин. За 161 год своего существования Каракорум около 40 лет был столицей Монгольской империи, куда из покоренных стран непрерывным потоком шли караваны с драгоценностями и утварью. Вторжение китайских войск в 1380 г. и междоусобные войны монгольских феодалов сильно разрушили город. На протяжении последующих 200 лет город неоднократно грабили и жгли, в результате от древней столицы почти ничего не осталось – ни развалин зданий, ни камней от них. По версии историков из разрушенных каменных строений Каракорума в 1586 г. был построен первый буддийский монастырь в Монголии – Эрдэнэ-дзу, поэтому на месте Каракорума не осталось никаких следов каменных строений. Раскопки 1948–1949 гг. и изучение культурного слоя толщиной в 5 метров позволило утверждать о двух сильных, пережитых городом пожарах.
    В сборнике трудов Орхонской экспедиции 1892 г. выводы о принадлежности развалин древней столице монголов Каракоруму обосновываются следующими словами: «К северу от монастыря Эрдэнэ-дзу находятся развалины древнего города, окруженного с трех сторон незначительным валом. В самом городе заметны маленькие валы и холмы – остатки прежних домов, между которыми ясно видны две главные, перекрещивающиеся улицы. На SE углу города громадная черепаха с четырехугольным отверстием в спине для вставления громадной могильной плиты, подобной памятнику Кюль-Тегина. От плиты с надписями не осталось следов. Вокруг черепахи вал и 5 значительных курганов, из которых средний – громадного объема. На территории монастыря нами описаны камни с надписями, привезенные в монастырь из окрестностей. Особенно часто встречаются камни с китайскими знаками «Хо-линь» и «Та-хо-линь» (китайское название города) и с персидскими надписями «Шэхръ Ханбалыкъ» (персидское название города), переведены нами как название города Каракорум. Все эти камни, привезенные в монастырь из близлежащего разрушенного города, доказывают, что этот город был столицей первых чингисидов – Каракорум, что и вполне совпадает с известием китайцев, что Каракорум находится в 100 ли к S от Угей-нора»1. Правильно ли китайские иероглифы «Та-хо-линь» отождествили с названием Каракорум?Научные споры о местонахождении Каракорума продолжались. Показательно одно из писем на французском языке от профессора Школы Восточных языков в Париже г-на Ж. Девериа, адресованное Н. Ядренцеву. Письмо было случайно обнаружено в фондах Иркутского областного краеведческого музея Иркутска в 1965 г. Ниже полный текст этого письма:
    «Каракорум монголов находился на территории древней столицы уйгуров, но не том же месте. В своей статье, опубликованной в Бюллетене Российской Академии наук, г-н Кок, приводит один фрагмент китайской записи о Каракоруме, принадлежащей Йо-лю-чу, государственному деятелю, современнику Огдоя (Угэдэй, XIII в.). Вот более полное изложение этой записи: «В 1235 г. император Тайцонг (Угэдэй) основал город Хо-лин и возвел в нем дворец Уан-Нган Конг. В 70-ти ли на северо-запад от Холина находятся остатки прежнего великого города и дворца Пи-Кья-Кхо-Хан (уйгурский хан Пик). В 70-ти ли на северо-западе от Холина находится стела с надписью китайского императора Хюнан-Цонга, воздвигнутая этим сувереном в 731 г. в память о тюркском принце Кьюэ Тегине (Кен-Чогхин)». Стела, о которой Йо-Лю-Чу свидетельствует как очевидец, является, как Вы знаете, двуязычной стелой, обнаруженной г-ном Хенкелем в прошлом году. Точное знание местонахождения этой двуязычной стелы, может способствовать решительным образом в нашем научном поиске того, где была древняя столица уйгуров, и доказать окончательно, что Ваш Кара Балгозун и есть действительно древняя столица монголов»2.
    Стела Кюль-Тегина 731 г. находится на северо-востоке на расстоянии 30 км от монастыря Эрдэнэ-Дзу и если ее за время своего существования не переносили с места на место, то ее местонахождение не совпадает с описываемым относительно Каракорума.
    В конце XIX в. А.И. Позднеев на основе анализа многочисленных письменных источников подтвердил предположение Н.М. Ядренцева о местонахождении Каракорума на берегах реки Орхон. В 1948–1949 гг. специальная археологическая экспедиция советских и монгольских ученых под руководством член-корреспондента АН СССР С.В. Кисилевым окончательно подтвердила вывод о том, что найденные развалины принадлежат столице чингизидов – Каракоруму. Это заключение было сделано на находках чугунолитейного производства, которое могло быть использовано для военных нужд (впрочем, точно также оно могло использоваться и в мирных целях). Раскопки обнаружили квартал ремесленников, специализирующийся на металлургическом производстве оружия и снаряжения для армии, были обнаружены бронзовые втулки для боевых колесниц внешним диаметром до 9 см. (или хозяйственных повозок для перевозки юрт?). В ремесленных кварталах были раскопаны кузнечные и железообрабатывающие мастерские с десятью печами для выплавки металла. К востоку от города, по мнению ученых, располагались пашни с орошаемыми каналами. Были также найдены египетские статуэтки, что свидетельствует о торговых связях с дальними странами и сельскохозяйственные инструменты. Несмотря на то, что город жил главным образом привозным хлебом и рисом, его окружали обширные, хорошо орошаемые с помощью каналов, земледельческие пашни3. Но является ли обнаружение ремесленного квартала доказательством тождества этого города Каракоруму, подобные кварталы были во всех средневековых городах.
    Ниже публикуются извлечения из книги руководителя археологической экспедиции С.В. Киселева «Древнемонгольские города»: «Вопрос о местонахождении Каракорума был решен после всесторонних исследований русских ученых, начавшихся еще во второй половине XIX века. В 1889 году Н.М. Ядринцев обследовал остатки большого древнего города на правом берегу Орхона, у стен древнейшего монгольского монастыря Эрдэни-Цзу. Уже тогда он высказал обоснованное предположение о том, что это развалины столицы Чингизидов. Дальнейшее подтверждение этот вывод получил в трудах крупнейшего монголиста профессора А.М.Позднеева, который посетил развалины, а также подверг блестящему анализу все документы, касающиеся монастыря Эрдэни-Цзу.
    При строительстве зданий и стен монастыря Эрдэни-Цзу широко использовались остатки каменных построек Каракорума, а также отдельные каменные плиты, в том числе плиты с ханскими указами и документами, укрепленные на больших, сохранившихся до сих пор каменных черепахах, установленных в разных концах города. Извлечение и использование подобного рода материалов продолжались и в более позднее время при неоднократных ремонтах и перестройках монастыря. Таким образом, в стенах, храмах и субурганах Эрдэни-Цзу оказались замурованными ценнейшие эпиграфические документы по древней истории монголов, по истории их столицы. Некоторые из таких документов были выявлены во время работ Орхонской экспедиции 1889 года, возглавлявшейся академиком В.В.Радловым.
    Правда, В.В.Радлов, занимаясь главным образом памятниками тюркской, орхонской письменности VII–IX веков, уделил меньше внимания воспроизведенным им в «Атласе экспедиции» (СПб, 1899 г.) двум фрагментам древнемонгольской надписи с параллельным китайским текстом. Однако он правильно отнес их ко времени хана Мункэ (1251–1259) и видел в них ценнейшее доказательство правильности предположений, что Каракорум стоял на местности около позднее возведенного монастыря Эрдэни-Цзу.
    В 1912 году В.Л. Котвич обнаружил в Эрдэни-Цзу еще три фрагмента и установил, что все они принадлежат той же надписи, два обломка которой найдены и изданы В.В. Радловым. В.Л. Котвич заключил, что все эти фрагменты – остатки надписи, составленной Хин Юань-ко и упомянутой в китайском тексте «Сокровенного сказания».
    Во время археологических исследований, проведенных в большом масштабе на городище Каракорума в 1948–1949 годы, был окончательно решен вопрос о местонахождении города. Город предстал таким, каким его описывал Гильом де Рубрук. Совпадения результатов раскопок с описаниями Рубрука в ряде случаев поразительны. Подтверждена характеристика отдельных районов города, вскрыты остатки дворца, местоположение и особенности конструкции которого в значительной мере соответствуют описанию. Рубрук сообщает о торговле хлебом, которая велась у восточных ворот города. При раскопках установлено, что именно с восточной стороны к городу примыкали большие искусственно орошаемые пашни. Огромное количество металлических, глиняных, деревянных, костяных и стеклянных изделий и следы их производства согласуются с указанием Рубрука о ремесленных кварталах Каракорума.
    Сотни монет, найденных при раскопках, десятки надписей на сосудах, печати, характерные фарфоровые и селадоновые чаши – все это позволяет, без всякого сомнения, отнести основную толщу культурного слоя (а на большей части городища – и весь слой) ко времени Чингизидов. Есть вещи, непосредственно свидетельствующие о том, что перед нами – развалины столицы, местопребывания ханской ставки. Это остатки покрывавшей дворец черепицы с красной поливной поверхностью. Черепица красного цвета могла, по долго сохранявшемуся обычаю, покрывать только ханский дворец. Очень важна находка деревянной печати с надписью, исполненной так называемым «квадратным письмом», означающей слово «иджи» – «приказание», с которого обычно начинались приказы императрицы»4.
    В приведенной длинной цитате с обоснованием версии о принадлежности раскопанных строений легендарному Каракоруму интересен ход рассуждений ученых о совпадении раскопок описанию Гильом де Рубрука. Только верно ли это утверждение на самом деле? Ремесленные кварталы были во всех средневековых городах, а вот самый главный доказательный аргумент, описываемый храм Угэдэя не совпадает полностью с раскопанным строением.По свидетельству знаменитых европейских путешественников Плано Карпини (1246 г.), Гильома де Рубрука (1254 г.), Марко Поло (1274 г.), Каракорум, того времени, производил незабываемое впечатление, особо отмечалось великолепие ханского дворца Тумэн-Амгалана и знаменитое серебряное дерево с чудесным фонтаном, установленное перед дворцом. Внутри дерева были проведены четыре трубы вплоть до его верхушки; отверстия труб обращены вниз, и каждое из них сделано в виде пасти позолоченной змеи. Из одной пасти лилось вино, из другой – очищенное молоко, из третьей – напиток меда, из четвертой – рисовое пиво. Описание подобных металлических деревьев и чаш с змеиными головами для питья можно встретить в разных средневековых текстах. Так, у странствующего монаха Одорико де Пордоне, посетившего Китай в 1324–1328 гг., есть описание ханского дворца Великого хана в Пекине: «Дворец весьма велик, внутри – двадцать четыре золотых колонны. А посреди дворца расположена большая чаша высотой в два двойных шага (2,96 м), изготовленная из цельного куска камня под названием «мердохай» (яшма). Она оправлена золотом, и по всем стонам от нее – змеи, разинувшие ужасную пасть, а еще она украшена жемчужной сетью. В эту чашу питье доставляется по желобу, который мдет по царскому дворцу. Рядом с этой чашей поставлено множество золотых сосудов, и каждый пьет сколько хочет»5. Подобные драгоценные деревья были известны и на Западе. Сохранилось описание 955 г. Большой Золотой Палаты царского дворца рядом с собором Святой Софии в Царьграде: «Еще чудеснее было стоящее неподалеку от трона золотое дерево, тополь или явор, на котором сидело множество золотых же птиц разной породы, изукрашенных цветными каменьями, которые точно так же в известное время се воспевали, точно живые»6.
    Самое подробное описание серебряного дерева в ханском дворце оставил Гильом де Рубрук: «В Каракоруме имеется также много домов, длинных как риги, куда убирают съестные припасы хана и сокровища. Так как в этот большой дворец непристойно было вносить бурдюки с молоком и другими напитками, то при входе в него мастер Вильгельм парижский сделал для хана большое серебряное дерево, у корней которого находилось четыре серебряных льва, имевших внутри трубу, причем все они изрыгали белое кобылье молоко. И внутрь дерева проведены были четыре трубы вплоть до его верхушки; отверстия этих труб были обращены вниз, и каждое из них сделано было в виде пасти позолоченной змеи, хвосты которых обвивали ствол дерева. Из одной из этих труб лилось вино, из – другой каракосмос, то есть очищенное кобылье молоко, из третьей – бал, то есть напиток из меду, из четвертой – рисовое пиво, именуемое террацина. Для принятия всякого напитка устроен был у подножия дерева между четырьмя трубами особый серебряный сосуд. На самом верху сделал Вильгельм ангела, державшего трубу, а под деревом устроил подземную пещеру, в которой мог спрятаться человек. Через сердцевину дерева вплоть до ангела поднималась труба. И сначала он устроил раздувальные мехи, но они не давали достаточно ветра. Вне дворца находился подвал, в котором были спрятаны напитки, и там стояли прислужники, готовые потчевать, когда они услышат звук трубы ангела. А на дереве ветки, листья и груши были серебряные»7. Гость хана, желающий выпить, обращался к ангелу на дереве, тогда человек прятавшийся в помещении под деревом через систему труб отдавал команду на подачу вина из подвала, находящегося вне дворца. По мнению историков, рисовое пиво, могли получать из Китая, а мед с Алтая и из Средней Азии.
    Несколько иначе золотые украшения ханского дворца описаны у Рашид ад-Дина: «Угэдэй-хан приказал, чтобы знаменитые золотых дел мастера сделали для шараб-ханэ из золота и серебра настольную утварь в форме животных, как-то: слона, тигра, лошади и других. Их поставили вместо больших чаш для питья и наполнили вином и кумысом. Перед каждой фигурой устроили хауз из серебра; из отверстий тех фигур лилось вино и кумыс и текло в хаузы»8. Оба описания относятся к одному и тому же дворцу Угэдэя, которое из них ближе к истине неизвестно. Описание Рубрука приобрело большую известность. Согласно нему художником в XVIII в. была нарисована гравюра, реконструирующая внешний вид серебряного дерева, которая в настоящее время украшает бумажные монгольские деньги.
    Большие строительные работы в Каракоруме, провозглашенной столицей монгольской империи, развернулись при втором Великом хане Угэдэе, третьем сыне Чингисхана. Строительство города было в основном завершено в 1236 г. Территория его в форме четырехугольника размерами примерно 2,5 на 1,5 км была обнесена невысокой глинобитной крепостной стеной. У большой башни в крепости стоял красивый дворец Угэдэй-хана – Тумэнамгалан (Десять тысяч благоденствий или десяти тысячекратное спокойствие). В китайской хронике Ганн-Му есть запись об обведении города стеной и завершении строительства весной 1235 г. дворца Туммэн-Амгалан для Угэдэй-хана: «Хорин был прежний город хойхорского Пици-хана, жившего при династии Тхан, Монголы прежде назначали его сборным местом, а ныне обвели стеною, имевшею около 5 ли (2,1 км) окружности»9.
    Храм располагался в юго-западной части города на насыпной платформе высотой 1,5 метра, со стенами длиной на расстояние дальности полета стрелы. Дворец простирался с севера на юг, его вход был обращен на восток, двухъярусные шатровые крыши были украшены поливной черепицей зеленого и красного цвета, большим количеством скульптурных фигур наполовину драконов, наполовину львов. Найденные фрагменты красной черепицы могут указывать на принадлежность дворца членам ханского рода, которые вплоть до XVIII в. одни имели право украшать кровли своих резиденций желтой и красной черепицей10. Но также найдено много значительно больше зеленой черепицы.В 1998 г. во время визита в Монголию федерального канцлера Германии Р. Герцога было подписано соглашение о раскопках в Каракоруме. В 1999–2004 гг. небольшая группа немецких ученых из института археологии Боннского университета совместно с монгольскими археологами вели раскопки. Были полностью откопаны помещение для строителей ханского дворца и четыре огромных печи для обжига кирпича. В большом количестве обнаружены осколки кровельной, зеленой черепицы. Раскапываемое строение было построено из хорошо сформированного и обожженного кирпича, оборудовано отопительными системами, при которых дымовые каналы проходили под полами помещений или под лежанками. Археологами на глубине 1,5 м вскрыто плиточное изразцовое покрытие пола прекрасного зеленого пола. Под дворцом обнаружены остатки буддийской кумирни начала XIII в. со стенной росписью (?). Раскопки храма позволили точно определить его размеры. Фундамент дворца имеет размеры сорок на сорок метров, а круглые деревянные ряды колонн делили его на шесть частей. План его определили по обнаруженным массивным гранитным плитам, каждая площадью примерно 1 м2. Предполагают, что на них могли стоять 72 деревянных колонны, 30 стояли вдоль стен, остальные сорок поддерживали крышу. Трехэтажная архитектура дворца в китайском стиле аналогична зданиям в зимнем дворце Богдо-хана Улаанбаатора. Обнаруженные остатки керамических плиток крыши и украшений, подобны находимым в китайских зданиях и буддийских храмах. Размещение отдельных павильонов на связанных насыпных платформах стандартно для китайских проектов дворцовых ансамблей. Итоги раскопок отражены в изданной в Германии книге «Чингисхан и его наследие».
    В летописях Рашид ад-Дина, однако, говорится о значительно большем дворце, со стороной дворца в один полет стрелы11, а это составляет около 400–500 метров. Короткие луки монголов имели дальность стрельбы более 275 м. Один полет стрелы в XIII в., согласно переводу текста чингисова камня состаляет: «Есунхэ выстрелил (из лука) на 335 саженей» (335 саженей составляют приблизительно 400 метров). Мировой рекорд стрельбы на дальность из современного лука сегодня составляет – 1854 м. В свете этих цифр трудно поверить, что раскапываемое строение со стороной стены в 40 м является искомым храмом Угэдэя.
    Несмотря на то, что большая часть плитки дворца освобождена из-под земли, каких либо следов подземных помещений для обслуживания знаменитого серебряного дерева под полом не обнаружено. Не совпадает с описанием дворца и внутреннее пространство раскопанного здания. По описанию Гильома де Рубрука: «Дворец этот напоминает церковь, имея в середине корабль, а две боковые стороны его отделены двумя рядами колонн, внутри стоит серебряное дерево, а сам хан сидит на возвышаюшенном месте с северной стороны. К его престолу ведут две лестницы. Пространство, находящееся в середине между деревом и лестницами, по которым поднимаются к хану, остается пустым»12. В раскопанном строении центр помещения занят гранитными основаниями под ряды колонн, которые ровным шагом разделяют равномерно все внутренне пространство, и пустого места в центре здания практически не остается.Среди найденных вещей при раскопках храма: браслет, китайское зеркало – толи, золотая пряжка, множество китайских монет, самой сенсационной находкой стала печать, найденная в марте 2002 г. Хорошо сохранившаяся латунная печать, содержит уйгурскую надпись, с указанием времени ее отливки: «на 2-ом году правления Сюньгуана», – это родовое имя Билигт-хана, старшего сына Тогоонтимура, первого малого хана Монголии, правящего в 1370–1378 гг. в Каракоруме. Печать была отлита в 1371 г. и принадлежала главе финансового ведомства одного из шести министерств правительства средневековой Монголии. При раскопках найдено большое количество китайских монет, однако среди них нет золотоордынских, арабских дирхемов и динар, которые по свидетельству Рашид ад-Дина были в огромных количествах в казнохранилище Угэдэй-хана.
    Несмотря на найденные находки и убедительные доводы ученых, все равно остаются сомнения была ли это столица монгольской империи Каракорум или это небольшой провинциальный город одной из крайних провинций Китая, в котором находился китайский военный гарнизон для охраны пахотных земель. Монгольские археологи опубликовали в 2004 г. статью о раскопках в Хархорине, в которой говорится, что найдено свыше 400 археологических предметов, много китайских монет эпохи Сун. Из числа найденных предметов преобладают буддийские, что наталкивает на предположение о том, что, возможно, это не храм Угэдэя, а буддийский комплекс более позднего времени.
    В газете «Монголия сегодня» было опубликовано интервью с профессором Института археологии АН Монголии Д. Баяром:
    Корреспондент: «В одном из докладов, касающихся раскопок Каракорума, отмечалось, что остатки сооружения, ранее считавшегося дворцом Угэдей-хана, теперь принимают за буддийский храм. Исходя из этого, можно ли утверждать, что монголы исповедовали буддизм еще при Чингисхане?»
    Д. Баяр: «В результате раскопок этого дворца, проведенных Совместной монголо-российской экспедицией в 1948–1949 годах, мы пришли к заключению, что это дворец Огоодей-хана. Кроме того, в то время было обнаружено большое количество культовых предметов, которые отнесли к более позднему периоду создания храма Эрдэнэ-Дзу. А согласно исследованиям, проведенных нами, установлена принадлежность этих культовых предметов к ХIII веку. Но предстоит еще ответить на вопрос: Угэдэй-хан держал во дворе столько культовых предметов или это действительно буддийский храм? Перед этим зданием стоит большая каменная черепаха. Помимо этого, найдены фрагменты обелиска, стоявшего на спине черепахи и расшифрованы надписи на них, гласящие: «Здесь возведен большой храмовый субурган и водружены многие божества». Исходя из этого, можно заключить, что это храм. Конечно, полную ясность внесут только более детальные исследования.
    Дворец стоял на искусственном холме, сложенном из чередующихся слоев песка и глины. Но холм был насыпан не на пустом месте. В подстилающих его слоях найдены остатки буддийской кумирни с цветными фресками, относящимися по стилю к XII веку или, скорее, к началу XIII века».По количеству и богатству археологических находок монгольский Хархорин, пока сильно проигрывает раскопкам в золотоордынских городах нижнего Поволжья, украшенных резным камнем городов Крыма и Волжской Булгарии, с многочисленными находками там роскошных серебряных и золотых поясных наборов, браслетов и серег. В отличие от раскопок в Хархорине археологические экспедиции в Сарае и Булгаре дали богатейший археологический материал и о результатах раскопок опубликованы многочисленные научные статьи и фотоальбомы. Вероятно, будущие публикации о результатах работы германо-монгольской археологической экспедиции в Хархорине, смогут наконец внести определенность в датировку раскапываемых объектов и их предназначение.
    О Каракоруме в «Истории монголов» Плано Карпини пишет следующее: «В одной части земли находится несколько небольших лесов... Далее даже и сотая часть вышеназванной земли не плодородна, и она не может даже приносить плода, если не орошается речными водами. Но вод и ручьев там немного, а реки очень редки, откуда там нет селений, а также каких-нибудь городов, за исключением одного, который слывет довольно хорошим и называется Каракорон, но мы его не видели, а были почти за полдня пути до него, когда находились в Сыр-Орде, каковая является главным двором их императора. И хотя в других отношениях земля не плодородна, она все же достаточно, хотя и не особенно, пригодна для разведения скота»13. Францисканцы, прибывшие на коронацию великого хана, отмечают пышность и роскошь праздничных ритуалов, затмевающих аналогичные западные церемонии.
    По свидетельству Гильом де Рубрука (1256 г.): «В настоящей земле монголов, где находится двор Чингиса не было ни одного города. Единственный город Каракорум имеет два квартала, один сарацин, в котором бывает базар, и многие купцы стекаются туда из-за двора, который постоянно находится вблизи него, и из-за обилия послов; другой квартал катайцев, которые все ремесленники. Вне этих кварталов находятся большие дворцы, принадлежащие придворным секретарям. Там находится двенадцать кумирен различных народов, две мечети, в которых провозглашают закон Магомета, и одна христианская церковь на краю города. Город окружен глиняной стеной и имеет 4 ворот»14. Там имеется также много домов, длинных как риги, куда убирают съестные припасы и сокровища.
    Марко Поло (1295 г.): «Город Каракорон в округе три мили, им первым овладели татары, когда вышли из своей страны... в той стране большие равнины и нет там жилья, ни городов, ни замков, но славные там пастбища, большие реки и воды там вдоволь. Вокруг Каракорума был большой земляной вал. Возле него находилась большая крепость, внутри которой располагался прекрасный дворец хана. Каракорум в округе имел 3 мили»15.
    Персидский историк Ращид ад-Дин пишет: «Угэдэй-каан приказал построить в своем юрте Каракоруме, где он по большей части в благополучии пребывал, дворец с очень высоким основанием и колоннами, как и приличествует высоким помыслам такого государя. Каждая сторона того дворца была длиной в полет стрелы. Посередине воздвигли величественный и высокий кушк и украсили то строение наилучшим образом и разрисовали живописью и изображениями и назвали его «карши» (дворец). Каан сделал его своим благословенным престольным местом. Последовал указ, чтобы каждый из его братьев, сыновей и прочих царевичей, состоящих при нем, построил в окрестностях дворца по прекрасному дому. Все повиновались приказу. Когда те здания были окончены и стали прилегать одно к другому, то их оказалось целое множество»16.
    Одной из крупнейшей построек города был большой 5-ти ярусный буддийский храм, построенный в 1256 г. по указанию Мунхэ-хана. Высота его достигала 300 чи (1 чи = 0,31 м), ширина 7 жан, или 22 м, на нижнем этаже в четырех стенах находились статуи различных божеств17.Археологи, до сих пор, не могут обнаружить следов этих каменных зданий, которых должно быть «целое множество», а также кумирен, часовен и монастырей, известных из описаний Каракорума, и теперь заявляют, что, вероятно, город состоял из большого количества разборных войлочных юрт. Найти фундаменты буддийского храма, других каменных дворцов и 13 каменных храмов, известных по описанию в Каракоруме, не удалось, хотя слой земли, под которым они должны находиться, не столь велик – около 1,5 метров. Сожженный и разрушенный Каракорум не оставил после себя ничего заметного. В 1999 г. вся территория предполагаемого города, тщательно, метр за метром была исследована геофизиками при помощи магнитометра – прибора, регистрирующего аномалии в естественном магнитном поле земли. Никаких сенсаций не случилось.
    Население Каракорума по мнению археологов составляло примерно 30 тыс. человек. Археологические исследования подтвердили, что на этом месте раньше было поселение с малочисленными каменными строениями, но был ли этот город искомым Каракорумом?
    Сомнения в правильности отождествления То-Хо-линя на реке Орхон со столицей Монгольской империи городом Каракорумом усиливаются после чтения летописей Рашид ад-Дина. Во-первых, из текста следует, что столица чингизидов находится у подножия чрезвычайно больших и высоких гор (в окрестностях монгольского Хархорина таких гор нет), во-вторых, в тексте неоднократно указывается, что Каракорум находится в Уйгуристане (Турфан, современная Туркестан), рядом с ним имеются города Талас (совр. Джамбул) и Кары-Сайрам (эти города находятся в районе р. Сырдарьи). И хотя в комментариях неоднократно подчеркивается, что было два Каракорума один в Монголии, другой в районе Сырдарьи отличить один город от другого в тексте просто невозможно. Сведения о двух Каракорумах встречаются и у современных авторов. Ф. Оссендовский, написавший знаменитую книгу о скитаниях в Монголии, сообщает: «Чингисхан воздвиг два Каракорума – один здесь, около Татса-Гола на древнем караванном пути, а другой на Памире; там-то осиротевшие воины и похоронили величайшего из земных завоевателей – в мавзолее, воздвигнутом пятью сотнями рабов, сразу же по окончании работ принесенных в жертву духу покойного»18.
    Перевод сборника летописей Рашид ад-Дина, выполненный коллективом научных работников Института востоковедения АН СССР в 1939 г., до сих пор остается без историко-географического и терминологического комментариев. Четвертый том с комментариями и историческими картами не был издан. Из десятка названий рек приводимых в описании местности вблизи Каракорума, отождествлена лишь одна, на основании чего собственно переводчик-востоковед И.Н. Березин и делает вывод, что описываемый город Каракорум находится в Монголии на реке Орхон. Эта река в оригинале текста пишется, как Ургун (Уркун). Вывод о местонахождении столицы Монгольской империи Каракорум в Монголии, сделан на основании отождествления названия только одной реки из 13-ти, упоминаемых в описании Рашид ад-Дина. Остальные двенадцать рек так и остались неизвестными, их не удалось отождествить. Интересно заметить, что такого количества рек просто нет рядом с монгольским Холинем.
    В персидских летописях говорится, что в Каракоруме живет огромное количество европейцев, в т.ч. золотых дел мастер родом из Парижа по имени Вильгельм Бушье, который сделал для хана большое серебряное дерево. Вызывает некоторое недоумение и большой перечень ремесленников, населявших Каракорум, среди которых присутствуют русские, французы, англичане, уроженцы Венгрии, большое количество армян и аланов, т.е. народностей населявших предгорья Кавказа и из Европы, как будто Каракорум находится не в Монголии, а рядом с Каспийским мореи. Гильом де Рубрук отмечает, что в Каракоруме «было большое количество христиан: венгерцев, аланов, русских, георгианов и армян».
    Описываемый быт и жизнь Каракорума в исторических описаниях пестрят деталями совершенно не характерными для Монголии. Например, вокруг Каракорума произрастает миндалевое дерево, для отопления жилищ используется красная ива, на рынке в изобилии продаются гранаты, дыни и грудные ягоды (ничего подобного в Монголии не произрастает). Казнохранилище в Каракоруме состояло из золотых и серебряных балышей, динаров и дирхемов, жемчуга. В казнохранилище было около двух туманов (тысяч) балышей. Часто встречается описание людей в тюрбанах и уйгурских эмиров, что характерно для Средней Азии, но не для Монголии. Пешком и на ослах в Каракорум из Персии приезжают старики за милостью, как будто это рядом, а не за 5000 км в Монголии.
    Персидский историк Рашид ад-Дин пишет: «Рассказывают, что в стране Уйгуристан имеются две чрезвычайно больших горы; имя одной – Букрату-Бозлук, а другой – Ушкун-Лук-Тэнгрим; между этими двумя горами находится гора Каракорум. Город, который построил Угэдэй-хан, также называется по имени этой горы. Подле тех двух гор есть гора, называемая Кут-таг. В районе этих гор в одной местности существует десять рек, а в другой местности – девять рек»19. Сторонники монгольского Каракорума, предполагают, что эта гора могла находиться в верховьях р. Орхон, где находится горный хребет Хангай.
    Название Каракорум на санскрите означает «Черная Осыпь». (Возможно, современная горная цепь Каратау, тянущейся вдоль правого берега р. Сырдарья). Современные исследователи соглашаются, что Каракорум – слово тюркское, а не монгольское. Остается непонятным присвоение монгольскому городу тюркского имени. По версии В. Бартольда Каракорум – тюркская форма монгольского названия Хара-Хорин, от названия реки Хар-Хорин, однако у Рашид ад-Дина конкретно говорится о названии города по имени горы Карокорум и это указание противоречит версии В. Бартольда. Еще одно оригинальное упоминание этого названия можно встретить в булгарских летописях, в которых запад называется – «кара», восток – «ак», север – «кук», а юг – «сара» или «сары». У Бахши Имана говорится: «Кара-Корым, то есть «Великая или Высокая стена». Также хоны называли и стену, которой чинцы отгородились от них. А слово «Корым» означало, кроме этого, и «ров», и «вал», и «лагерь»20. У слова «кара» имеется три значения: первое – запад, второе – черный, третье – большой, крупный, сильный, могучий, великий. Какой версии о происхождении названия отдать предпочтение, мнения разделяются, булгарской версии «Западный лагерь», «Великий лагерь» или по имени одноименной горы.
    Версия Рашид ад-Дина является наиболее авторитетной – Каракорум назван по имени одноименной горы Каракорон. Однако подобных гор рядом с местом раскопок города на монгольском Орхоне не существует. Если предположить, что все каменные строения Каракорума были полностью разрушены и вплоть до фундаментов использованы для строительства монастыря Эрдэнэ-Дзу, поэтому и не осталось никаких следов столицы, то, как объяснить куда исчезли «чрезвычайно высокие горы с вечным снегом на вершинах» одна из которых именовалась Каракорон?
    Если принять во внимание, в окружение каких географических названий в тексте летописей Рашид ад-Дина находится гора Каракорон, то искать ее надо не в Монголии, а в Средней Азии: «в пределах областей, которые известны под названиями Туркестана и Уйгуристана; по рекам и горам в областях народа найман, как, например, Кок-Ирдыш (совр. Синий Иртыш), Ирдыш (совр. Черный Иртыш), гора Каракорум (?), горы Алтая, река Орган (?) в области киргизов и кэм-кэмджуитов... В этой местности проживали народы кумук-атыкуз и лун».
    Название кэм-кэмджуит происходит от названия реки Кема или Кемджика. Под именем Кем известна река Енисей, берущая начало в Саянах, но под таким же древним названием известна и река Кама, берущая начало в горах Урала. В армянских источниках говорится, что Каракорум находится в стране на дальнем северо-востоке на границе Гатия (Скифии).
    В «Истории Завоевателя Мира», написанной Ата-Меликом Джувейни местожительство Каана описывается такими словами: «После того Хатым Века и Правитель Мира утвердился на троне царства и, успокоив свои мысли относительно похода в земли Китаев, торжественно направился в великую орду своего отца, собственную резиденцию, которая находилась неподалеку от Эмиля, он отдал своему сыну Гаюку, избрав для своего нового местожительства и столицы государства область на берегу реки Орхон, в горах Каракорум. В том месте прежде не было ни города, ни селения, кроме остатков крепостной стены, называемых Ордубалык. Во время его восшествия возле развалин крепости был найден камень, на котором была надпись, сообщавшая, что основателем этого места был Буку-хан. Монголы прозвали его Маубалык21, и Каан приказал построить там город, который был назван Ордубалык, хотя он больше известен как Каракорум. Туда были доставлены разные ремесленники из земель Китаев, а также мастера из стран ислама; и они начали вспахивать землю. И по причине великой щедрости и доброты Каана туда устремились люди из многих стран, и через короткое время это стал большой город»22.
    В Каракоруме сходились все нити управления огромной Монгольской империи. К нему были проложены дороги от главнейших городов сопредельных стран. Особенно хорошо было наложено движение на линии Каракорум – Пекин, на которой находилось 37 почтовых станций, расположенных через каждые 25–30 км. В летописях Рашид ад-Дин сообщает, что: «Из китайской страны до Каракорума расположили ямы. Через каждые пять фарсангов23 находился один ям. Вышло 37 ямов. На каждом перегоне для охраны тех ямов поставили по одной тысячи. Он установил такой порядок, чтобы ежедневно в Каракорум прибывали из областей пятьсот повозок, груженые съестными припасами и напитками...
    Он повелел, чтобы мастера-мусульмане построили кушк в одном дне пути от Каракорума, в том месте, где в древние времена находились сокольничие Афрасияба и построили замок и назвали его Карчаган. В двух фарсангах от города построили высокий кушк, названный им Тургу-Балык. Там посадили несколько саженцев ивы и миндаля... В окрестностях Каракорума есть клад, который зарыл Афрасияб»24.
    Афрасияб, легендарный враг иранцев, туранский шах, имя которого несколько раз упоминается рядом с названием города Каракорум проживал достаточно далеко от Монголии, трудно предположить, что туранский шах имел охотничьи угодья на далеком монгольском Орхоне, на расстоянии трех-четырех месяцев пути от своего дома. Его имя выбито на стенах закавказской крепости Сабаил (окрестности Баку, Каспийское море), которую не удалось взять штурмом даже воинам Чингисхана. Замок Сабаил ушел под воду Каспия примерно 800 лет назад и сейчас находится под водой. По прогнозу ученых уже в 2007 г. из-за усыхания Каспия легендарный замок окажется вновь на суше. Сооружение имеет форму сильно вытянутого прямоугольника с мощными каменными стенами толщиной около полутора метров, соединяющих 15 башен. Морская вода вплотную подходила к основанию крепости, так что могли швартоваться суда. По мнению ученых, вероятно, эта крепость погрузилась в воду после сильнейшего землетрясения в 1306 г. Уровень Каспия тогда поднялся примерно на 20 метров. На поверхность археологам удалось поднять из воды около 700 плит с надписями «Афрасиаб», «Худабенде», «Яхья», «Афридун». На одной из плит высечена дата – 632 год хиджры, соответствующий 1234–1235 гг. Столица Афрасиаба – Руиндиш, по описанию находилась также вблизи Каспийского моря. В знаменитом описании царей Фирдруоси «Шах-Наме» об Афрасиабе и его столице есть такие строки:
    «В охотничьих угодьях Афрасиаба
    Мы над Туранской степью прах взовьем...
    Со всей охотой шумной собрались
    И вскачь к реке Медвяной понеслись.
    В заветном Афрасиабовом угодье
    Гора налево, справа – многоводье,
    А за рекою – края нет степи
    Паслись газели и онагры там...
    Возносит Башни Руиндиш25 могучие
    Вокруг него, шумна и широка
    Как море разливается река,
    Арджаси, когда он замок покидает,
    На корабле реку переплывает»26.
    Запутанной и неясной выглядит связь легендарного Африсиаба, жившего значительно раньше Чингисхана, со столицей чингизидов – Каракорумом.Несоответствия в исторических текстах и отдельные факты, так и не получившие достаточного объяснения, до сих пор служат основанием для гипотез о возможном местонахождении столицы Монгольской империи в другом месте. Среди гипотез –Восточный Туркестан, в верховьях реки Сырдарья, далее следуют Иртыш и Забайкалье (на реке Унда, вблизи Нерчинска, к востоку от устья Онон), и даже, – река Волга и Дон.
    При Угэдэе провинция Лин-бэй, находившаяся в Северной Монголии, имела центр управления в То-Хо-лине (Каракоруме). Так может быть это и был только китайский провинциальный город То-Хо-линь, а столица монгольской империи Каракорум до сих пор не найдена?
    Согласно летописей Ращид-ад-дина останки Угэдэй-хана находятся «в запретном месте на горе, весьма высокой, на которой лежит вечный снег. С этой горы берут начало реки, которые впадают в реку Ирдыш. От той горы до Ирдыша два дня пути». Это также далеко от Каракорума в Монголии. Как могила Угэдэя оказалась в верховьях Иртыша?
    Исторические рассказы свидетельствуют о существовании еще нескольких кочевых дворцов-стоянок Чингисхана, одно из них находилось в урочище Дэлюн-болдок у реки Керулен под названием «Аургын ордон». В этом месте в 2004 г. японские археологи обнаружили предположительно первый дворец Чингисхана, раскопки которого продолжаются. Каменные дворцы и города начали воздвигаться монголами лишь в XVI в. после падения империи Юань. У реки Тола был построен дворец сыну Абатай хана Эрхий мэргэну, у реки Хануй – дворец Хархул хана, к 1500 году – город Хух Хото (ныне столица внутренней Монголии в Китае), белый дворец Цогту Тайджи в Дашинчилэн сомоне Булганского аймака.
    Кроме Каракорума ученым известны еще другие ранние средневековые городища с храмовыми постройками. Среди них – город на реке Хир-Хире в Забайкалье, отнесенного к раннемонгольским городам на основании найденного там «Чингисова камня» с памятной надписью о награждении Чингисханом своего племянника Исункэ. Кондуйский городок, находящийся в Забайкалье между реками Кондуй и Барун-Кондуй – притоками реки Урулюнгуй (примерно в 50 км к северу от Хирхоринского городища). Кондуйский дворец имел большое сходство с дворцом Угэдэя в Каракоруме. Города на территории современной Тувы: Ден-терек, на трех древних островах реки Элегест, Могойское, Межегейское, Элегетское городища. Здесь обнаружены следы металлургических мастерских, руда для которых добывалась в рудниках Тувы. Известный монгольский историк Ням-Осорын Цултэм в монографии «Искусство Монголии» пишет: «К сожалению, памятников архитектуры и градостроительства XIII–XIV веков сохранилось очень мало, большая часть была разрушена после падения юаньской династии в 1368 году. Остается лишь надеяться, что археологи и искусствоведы отыщут их следы и смогут поведать много нового. Еще меньше знаем мы об изобразительном искусстве монголов того времени»27.
    1В.В. Радлов. Сборник трудов Орхонской экспедиции 1892 г.
    2Краеведческие записки. 7 выпуск. Иркутск, 2000 г.
    3С.В. Киселев. Древние города Монголии. 1957 г.
    4С.В. Киселев. Древнемонгольские города. М., 1965 г.
    5Книга странствий. СПб., 2006 г., стр. 300.
    6А. Нечволодов. Сказание о Русской Земле. М., 2006 г., стр. 158.
    7Гильом де Рубрук. Путешествие в восточные страны. М., 1997 г., стр. 155.
    8Рашид ад-Дин. Сборник летописей. М., 2002 г., т. 2, стр. 40.
    9Н. Бичурин. История первых четырех ханов из дома чингисова. М., 2005 г., стр. 177.
    10С. Киселев. Древнемонгольские города. М., 1965 г., стр. 351.
    11Рядовой монгольский воин имел при себе короткий составной лук, сделанный из пластин дерева гибких пород, прикрепленных к центральному хлысту, и более длинный лук того же типа для стрельбы стоя. Дальность стрельбы этих луков превышала 250 ярдов (225 м).
    12Гильом де Рубрук. Путешествие в восточные страны. М., 1997 г., стр. 155.
    13Плано Карпини. История монгалов. М., 1997 г., стр. 32.
    14Гильом де Рубрук. Путешествие в Восточные страны. М., 1997 г., стр. 161.
    15Марко Поло. М., 1997 г. стр. 232.
    16Рашид ад-Дин. Сборник летописей. М., 2002 г. Книга 2, стр. 40.
    17Архитектура Монголии. Улан-Батор, 1988 г., стр. 4.
    18Ф. Оссендовский. И звери, и люди, и боги. М., 1994 г., стр. 220.
    19Рашид ад-Дин. Сборник летописей. М., 2002 г. Книга 1, стр. 146.
    20Бахши Иман. Летопись Джагфара (1680 г.), 171 глава.
    21Маубалык – «злой город», этим именем монголы называли афганский город Бамиан.
    22Ата-Мелик Джувейни. История Завоевателя Мира. М., 2004 г., стр. 163.
    231 фарсанг равен 5 километрам, обычно ямы располагались на расстоянии дневного перехода, через 25–30 км.
    24Рашид ад-Дин. Сборник летописей. М., 2002 г. Книга 2, стр. 41.
    25В географическом сочинении Хамдаллаха Казвини (1280–1349) «Нузхат ал-кулуб» («Услада сердец») дано подробное описание Азербайджана и упоминается Руиндиш. «На вершине горы Сабалан находится мощная крепость под названием Диз-Бахман или Руйин-Диз. В «Шах-намэ» Фирдоуси говорится, что во время борьбы за царство между Кей-Хосровом и Фарибурзом, они решили, что власть будет принадлежать тому, кто покорит эту крепость. Фарибурз не смог этого сделать, а Кей-Хосров покорил ее, и царство утвердилось за ним. Теперь эта крепость в руинах».
    26Фирдуоси. Шах-Наме. Сказание о Рустаме. М., 1980 г., стр. 119 и стр. 336.
    27Ням-Осорын Цултэм. Искусство Монголии с древнейших времен до начала ХХ века. М., 1986 г., стр. 46.

    image

    0
  • гыгы999
    1 ноября 2012  

    Или город мог называться КЭРЭ ХААРЫАН (Дорогое Прекрасное)

    У Рубрука название города оканчивалось на букву Н.

    0
    • Атас
      1 ноября 2012  

      Элементарно

      Ныне монголы этот город называют Хархорин. Он там типа районного центра, маленький городок. Проживает там, по моему, не более 3 тыс. человек. Долина реки Орхон. Там раньше стояла столица др. тюрков (Кюль Тегин, Билгэ каган и пр.), далее там же была столица уйгуров Ордубалык, а потом, прямо там же, Чингисхан воздвиг свою столицу. Великие места!
      В исторический документах город фигурирует как Каракорум. не надо ничего додумывать, это общеалтайский топоним, означает ЧЕРНЫЕ КАМНИ. У монголов периода Чингисхана Хара ХОРИН, у тюрков КАРА КОРУМ. У саха -- ХАРА это понятно -- черный. Для юго-западных якутов (например, у ленских, олекминских) КУРУМ это мелкие камни, каменистое место, гравий, щебенка. Сами наверно знаете. Так что, это -- наше.
      Кстати, настоящий якут, считающий себя осколком великой степной цивилизации, обязательно должен побывать в этих святых местах.

      0
      • гыгы999
        1 ноября 2012  

        Карта Коронелли.

        image
        Сегмент из «Книги глобусов» Коронелли. Венеция, 1693/1701 гг. На этой карте Каракорум размещен западнее Алтая, а не в Монголии, как это принято на современных картах. Легенда на карте: «К западу за горами Алкай, находятся земли мекритского народа, а регион этот именуется «Крит Мекрит, или Сисиан» со столицей Каракоран»

        0
  • гыгы999
    1 ноября 2012  

    Вот нашел про это форум)))

    Скрытый текст
    Я здесь приведу то, что я по этой теме писал на Евразике: http://forum-eurasica.ru/index.php?/...C/page__st__80

    Ас-Алан





    Что касается Каракорума, то это, очевидно, тюркское наименование: в переводе - "Чёрные россыпи камней". И потому, нет причины для дальнейшего рассмотрения этимологии данного названия.
    И ещё интересно: прежде, чем предположить "Каракорум" халхасский, бывшей столицей империи Чингис-хана, удосужились ли сторонники этой версии уточнить - есть ли на тех местах курумы - скопления камней?
    К примеру, типа такого:



    Курумы — глыбово-щебнистые накопления на склонах гор различной крутизны, сложенных скальными породами. Они образуют потоки обломочного материала, в плане напоминающие движение рек или ручьев. Здесь статья о курумах: http://www.egiki.ru/...%80%D1%83%D0%BC


    Вот, к примеру, ещё курумы:













    Я также посмотрел в интернете фото ландшафта окрестностей предполагаемого
    халхасского "Каракорума". И вот что обнаружил:








    Как видно, никаких курумов возле предполагаемого халхасского "Каракорума" - нет и быть, в принципе, не может. Т.к., курумы образовываются в других ландшафтных условиях. В тех местах, где могут образоваться курумы, горы должны быть настоящими горами. А не холмы и плоскогорья, какие можно видеть возле надуманного "Каракорума".

    Таким образом, Amicus Plato, sed magis arnica veritas - "Платон мне друг, но истина дороже". При всём уважении к монголам, приходится констатировать: то, что у них принято считать за Каракорум - столицу империи Чингис-хана, на самом деле таковой не является. С уважением.


    Стас (26 October 2009 - 06:22 PM):
    Вот ссылка на карту в гугле
    Каракорум
    Там можно оценить рельеф и найти это фото




    Ас-Алан






    Что за маленькая скала? Наличие подобной скалы, никак не поддерживает версию о возможности существования Каракорума в тех краях.
    Я карты посмотрел в Гугле. Только не понял в данном случае - для чего? Т.к., уже на на приведённых мной фотографиях достаточно прекрасно видно, что в том месте, где ошибочно предполагается "Каракорум", никаких курумов быть не может в принципе.






    В работе "Каракорум – сказочная столица Монгольской империи" её автор С. Волков весьма обоснованно критикует позицию тех, кто ищет Каракорум в Монголии. В том числе и результаты исследований, которые упоминал Стас.
    http://baikal.irkuts...?rubr=15&doc=74





    Сегмент из «Книги глобусов» Коронелли. Венеция, 1693/1701 гг. На этой карте Каракорум размещен западнее Алтая, а не в Монголии, как это принято считать сейчас.



    Некоторые из доводов с.Волкова:


    Сомнения в правильности отождествления То-Хо-линя на реке Орхон со столицей Монгольской империи городом Каракорумом усиливаются после чтения летописей Рашид ад-Дина. Во-первых, из текста следует, что столица чингизидов находится у подножия чрезвычайно больших и высоких гор (в окрестностях монгольского Хархорина таких гор нет), во-вторых, в тексте неоднократно указывается, что Каракорум находится в Уйгуристане (Турфан, современный Туркестан), рядом с ним имеются города Талас (совр. Джамбул) и Кары-Сайрам (эти города находятся в районе р. Сырдарьи)...

    Перевод сборника летописей Рашид ад-Дина, выполненный коллективом научных работников Института востоковедения АН СССР в 1939 г., до сих пор остается без историко-географического и терминологического комментариев. Четвертый том с комментариями и историческими картами не был издан. Из десятка названий рек приводимых в описании местности вблизи Каракорума, отождествлена лишь одна, на основании чего собственно переводчик-востоковед И.Н. Березин и делает вывод, что описываемый город Каракорум находится в Монголии на реке Орхон. Эта река в оригинале текста пишется, как Ургун (Уркун). Вывод о местонахождении столицы Монгольской империи Каракорум в Монголии, сделан на основании отождествления названия только одной реки из 13-ти, упоминаемых в описании Рашид ад-Дина. Остальные двенадцать рек так и остались неизвестными, их не удалось отождествить. Интересно заметить, что такого количества рек просто нет рядом с монгольским Холинем...

    Археологи, до сих пор, не могут обнаружить следов... каменных зданий, которых должно быть «целое множество»... известных из описаний Каракорума... Сожженный и разрушенный Каракорум не оставил после себя ничего заметного. В 1999 г. вся территория предполагаемого города, тщательно, метр за метром была исследована геофизиками при помощи магнитометра – прибора, регистрирующего аномалии в естественном магнитном поле земли. Никаких сенсаций не случилось...

    Описываемый быт и жизнь Каракорума в исторических описаниях пестрят деталями совершенно не характерными для Монголии. Например, вокруг Каракорума произрастает миндалевое дерево, для отопления жилищ используется красная ива, на рынке в изобилии продаются гранаты, дыни и грудные ягоды (ничего подобного в Монголии не произрастает)... Часто встречается описание людей в тюрбанах и уйгурских эмиров, что характерно для Средней Азии, но не для Монголии. Пешком и на ослах в Каракорум из Персии приезжают старики за милостью, как будто это рядом, а не за 5000 км в Монголии...

    Современные исследователи соглашаются, что Каракорум – слово тюркское, а не монгольское. Остается непонятным присвоение монгольскому городу тюркского имени. По версии В. Бартольда Каракорум – тюркская форма монгольского названия Хара-Хорин, от названия реки Хар-Хорин, однако у Рашид ад-Дина конкретно говорится о названии города по имени горы Карокорум и это указание противоречит версии В. Бартольда...

    Персидский историк Рашид ад-Дин пишет: «Рассказывают, что в стране Уйгуристан имеются две чрезвычайно больших горы; имя одной – Букрату-Бозлук, а другой – Ушкун-Лук-Тэнгрим; между этими двумя горами находится гора Каракорум. Город, который построил Угэдэй-хан, также называется по имени этой горы. Подле тех двух гор есть гора, называемая Кут-таг. В районе этих гор в одной местности существует десять рек, а в другой местности – девять рек»...

    Если предположить, что все каменные строения Каракорума были полностью разрушены и вплоть до фундаментов использованы для строительства монастыря Эрдэнэ-Дзу, поэтому и не осталось никаких следов столицы, то, как объяснить куда исчезли «чрезвычайно высокие горы с вечным снегом на вершинах»...?"

    Также есть такой интересный довод:

    "Он (Чингисхан - А.-А.) повелел, чтобы мастера-мусульмане построили кушк в одном дне пути от Каракорума, в том месте, где в древние времена находились сокольничие Афрасияба и построили замок и назвали его Карчаган. В двух фарсангах от города построили высокий кушк, названный им Тургу-Балык. Там посадили несколько саженцев ивы и миндаля... В окрестностях Каракорума есть клад, который зарыл Афрасияб». Афрасияб, легендарный враг иранцев, туранский шах, имя которого несколько раз упоминается рядом с названием города Каракорум проживал достаточно далеко от Монголии, трудно предположить, что туранский шах имел охотничьи угодья на далеком монгольском Орхоне, на расстоянии трех-четырех месяцев пути от своего дома. ".




    Rust (21 November 2009 - 05:24 AM):

    Итог: возможно предположить, что декларируемый как Каракорум город является То-Хо-линем, значит настоящий Кара-Корум предстоит еще найти...

    МОЖЕТ ДЕЛО В НАЗВАНИИ)))ТОГДА ВСЕ СТАНЕТ НА СВОИ МЕСТА, НЕ НАДО ИСКАТЬ ГОРЫ, КРАСИВЫЙ ГОРОД МОЖЕТ БЫТЬ ПОСТРОЕН И В ПУСТЫНЕ.

    0
    • Оidоv
      1 ноября 2012  

      Родословная ЧХана , вкратце и частично . Источник -

      Это подтверждение свидетельству Марко Поло . Выделил большими буквами ЖИН - ДЬИ5 и другие . БОРДЖИГИДАЙ Мэрген его жена монголдЖИН Гоа , ТороголдЖИН Баян имел жену Борохчин Гоа . Сыновья ТороголдЖИН Баяна Дува СОХОР и ДОБУН Мэрген . БАРГУДЖИН Гоа дочь Бархудай Мэргена . Владелец земель Кол - БАРГУДЖИН Тухум ( Токко - Токума , сноска моя ) , выдана замуж за ХОРИ ТУМАТСКОГО - ХорилТАЙ Мергена . Алан Гоа была дочерью Хори Туматского в земле хори тумат в местности Арих Усун ( длинный остров или река - сноска моя ) . Направлялись к владельцам Бурхан Халдун Бурхан Босrахсану и Шэньги Баяну из племени УРЯНХАЙ . Алан Гоу придя в дом ДОБУН Мэргена родила двух сыновей БУГУНУТАЙ и БэлгунуТАЙ . Продолжение следует .

      0
      • Оidоv
        1 ноября 2012  

        У Дува СОХОРа было четыре сына .

        После его смерти откочевали образовали четыре рода ДОРБЭН ИРГЭН . встретил из племени Маалих БАЯУДай всего у Алан Гоа пять сыновей . Три после смерти Бугу Хатаги , Бухату , Салджи Бодончар . Отступлю мест МУНХАЛ , ЭДЭР АЛАЙ - перевал . КОКСЭу - САБРАХ - найман . Всё - Достал из старых своих заметок .

        0
  • гыгы999
    1 ноября 2012  

    Все таки Огуз скорее всего.

    Скрытый текст
    Однажды Кара-хан устроил [своим] снохам пиршество, выказал им ласку и спросил: «Так как эти две первые снохи [мои] красивее, чем последняя, то как случилось, что мой сын любит ее больше, чем их. Он все время ходит к ней и с ней общается, а на двух первых не обращает внимания?!». Так как те две снохи были недовольны своим мужем и весьма ревновали его, то, найдя удобный случай, они выступили против мужа и сказали: «Он принял другую веру – верит в бога небес и земли, возлюбил его и желал, чтобы мы также согласились с ним, [но] мы отвергли [его предложение] и не обратили внимания |А 9б| на его речи. По той самой причине он относится к нам [крайне] недоброжелательно. А та невестка [твоя] так же, как и он, уверовала в бога, стала с ним согласной и единомысленной. Естественно, что он ее любит, а нас ненавидит». [83]

    В это время Огуз с нукерами 284 (дружинниками) и с некоторыми из своих друзей был на охоте. Кара-хан, собрав братьев, племянников, родственников и эмиров, сказал им: «Мой сын Огуз в раннем детстве казался баловнем судьбы и очень способным, и я был сердечно привязан к нему, [но] в настоящее время он предпринял злое дело: отвратился от нашей веры, [почему] его нельзя оставить в живых». Все то собрание от этих слов пришло в ярость [букв. оскорбилось], и все единодушно порешили умертвить Огуза.

    Жена Огуза, бывшая согласною с ним, когда узнала об этом обстоятельстве, тотчас послала к нему одну женщину из своих соседок, которой она доверяла, дабы та известила мужа. Огуз подготовился к ратному строю и сражению и, известив всех своих нукеров и товарищей, созвал их к себе. Они тут же, на месте охоты, соединились друг с другом. Отец его, дядья и родственники [объединились] в намерении умертвить Огуза. Обе стороны построили войска в боевой порядок и вступили в сражение. [В этой битве] шашка [врага] настигла Кара-хана, и он умер от этой раны. Из-за того, что из числа дядьев и племен Огуза к нему присоединилось большое количество, они воевали друг с другом около семидесяти пяти лет и препирались за улус и войско.

    В конце концов Огуз победил и захватил область от Таласа и Сайрама до Бухары; она стала неоспоримо принадлежать ему. Некоторые его дядья, братья и племянники, которые к нему не присоединились, поселились [от него] на восток. Среди них так повелось считать, что все монголы [происходят] из их рода. В ту эпоху они все были неверными, но с течением времени они также стали вместе с родом [Чингиз-хана] исповедовать единобожие.

    Когда та область покорилась Огузу и закрепилось над нею его господство, он разбил золотой шатер и устроил великое празднество; почтил родственников и эмиров, обласкал всех воинов; всем дядьям и родам, которые к нему присоединились, он дал имя уйгур, так как значение этого слова на тюркском языке – соединяться и помогать. Все племена уйгуров [происходят] от их рода. Другое племя он назвал канлы. Племена: кипчак, калач и агач-эри также происходят от того народа, который соединился с Огузом и смешался с его родом. Причины наименования каждого [племени] подробно излагаются в нижеследующих разделах.

    УЙГУР оказывается ӨЙҮҮР.
    Кыпчаки, часть КАНГЛов, АГАЧ-ЭРИ (Аҕа-Сээри?) приняли мусульманство, ХАРА-ХАН был против мусульман, скорее всего верил в Таҥара, так произошел раскол одного народа.

    0
    • Могул
      1 ноября 2012  

      Гыгы999

      Гыгы999! Я как раз читал, то что дано выше, и своим комментарием(эмоциональным) вызвал у некоторых бурное веселье. И как только "неверные" становятся "верными" все верное становится неверным!
      Далее. Как видим из Ойдова имена предков ЧХ намного якутские чем те имена, которые дал нам Атас, и которые есть в самом деле, в силу своего обнаружения, чисто якутские. Но человек моего уровня знания языка сломает ноги, пытаясь понять что же это такое!
      И чего только стоят имена БЭЛГИНЭТЭЙ, БУГУНАТАЙ и тогдалия. Например, один из предков нюрбинцев Босхоҥ Бэлгэтии. Поэтому лично я считаю, что ЧЫНЫС хаан есть чистой воды ЯКУТ!

      0
      • гыгы999
        2 ноября 2012  

        Онтон сахалы тыллара баар дии.

        бурҕаҥнат=
        побуд. от бурҕаҥнаа =; буору манна бурҕаҥнатымаҥ не поднимайте здесь пыли, не пылите здесь.
        Бурҕаҥнатай-поднимающий пыль.

        0
      • гыгы999
        2 ноября 2012  

        Бэлгэнитэй

        бөлөҕөлөө=
        группировать, собирать кого-что-л. в одном месте, скучивать; сылгылары бөлөҕөлөө = согнать лошадей в одно место.
        бөлөҕөлөөнүөтүй- собери, скучь...

        ОКОНЧАНИЯ ТАЙ, ТҮЙ- СЛОВА ПРИКАЗЫ. ВООБЩЕ ЯКУТСКИЙ ЯЗЫК-ЭТО ЯЗЫК НАЧАЛЬНИКОВ, ОСОБЕННО ЦЕНТРАЛЬНЫЕ РАЙОНЫ, СЛОВА КОМАНДЫ. ВО ВРЕМЯ БОЕВЫХ ДЕЙСТВИЙ НЕ ДО РАЗГОВОРОВ, КРАТКОЕ СЛОВО-ПРИКАЗ.

        0
  • гыгы999
    1 ноября 2012  

    Могул можешь Эллэйаду забросить в Скрытый на топ? Проследим родословную.

    Скрытый текст
    Вот ты и нашел, хоть и долго водил нас за нос. Как то обыденно получилось. Этим и объясняется идентичность Эллэяды с Ветхим заветом.
    Отец Эллэя Карахаан (Татаар Тайма) оказывается есть сын Ноя! Для уточнения видимо будет нужен Сырдык. Поздравляю!

    Случайно нашел в словаре Хаҥалас= 1) человек, не прошедший обрезание, живущий "по природе" (антоним - өргүөт ).
    Значит часть КАНГлов, а именно те кто поддержал Харахана, вынуждена была откочевать из-за агрессивной экспансии исламской веры.
    Скрытый текст
    Исла́м (араб. إسلام‎‎ [ʔɪsˈlæːm]) — монотеистическая мировая религия. Слово «ислам» переводится как «покорность», «подчинение» (законам Аллаха)[1]. В шариатской терминологии ислам — это полное, абсолютное единобожие, подчинение Аллаху, его приказам и запретам, отстранение от многобожия. Приверженцев ислама называют мусульманами. Главная священная книга ислама — Коран. Язык богослужения — классический арабский. В окончательном виде ислам был сформулирован в проповедях пророка Мухаммеда в VII веке.

    А в какую сторону могли уйти тенгриацы? Конечно на восток, подальше от арабов и ближе к своим. Произошло это в VIII в. н.э.
    Посмотрим по истории до исламистов существовала империя Кектюрков.
    Скрытый текст
    Тю́ркский кагана́т, Тю́ркютский кагана́т (Кёктюрк — небесные тюрки) — крупное средневековое государство в Азии, созданное племенным союзом тюрок (тюркютов) во главе с правителями из рода Ашина. Одно из крупнейших государств в истории. В период наибольшего расширения (конец VI века) контролировало территории Северо-Восточного Китая (Маньчжурии), Монголии, Алтая, Восточного Туркестана, Западного Туркестана (Средней Азии), Казахстана и Северного Кавказа.

    Восточно-тюркский каганат
    Скрытый текст
    Восточно-тюркский каганат — государство кочевых[источник не указан 954 дня] тюрков. В 603 году произошёл распад Тюркского каганата на Западный и Восточный. Каганат имел общие протяжённые границы с Китаем и вёл частые войны с этим государством. Не раз отстаивал свою самостоятельность в крупных сражениях со своим южным соседом. Несколько крупных сражений, в которых каганат одержал победы, произошли в конце VII века и в первой половине VIII века.
    Танская империя захватила Восточный каганат в 630 году.
    Произошло восстание кок-тюрков во главе с Кутлугом в 682 году и восстановление Восточного каганата под именем Кок-Тюркский каганат. Кутлуг разгромил китайские войска в Синьчжоу в 686 году. Набег Мочура на Линчжоу в 694 году. Вторжение Мочура в Китай и разгром имперских войск в 698 году.
    .
    Вот наиболее вероятное время происхождения Эллэйады. Как раз сходится по времени по исламоизации этих каганатов.
    Скрытый текст
    После поражения в 745 году в битве с уйгурами под предводительством хана Моюн-Чура, на землях Восточного каганата возник Уйгурский каганат, просуществовавший с 745 по 840 годы.

    0
    • Могул
      1 ноября 2012  

      Гыгы999

      К сожалению в полной мере компьютером не владею, потому не могу перебросить. А вот то, что дети вольной веры были оттеснены, считаю возможным. Это как показано тобою сходится по времени. К тому же поданные тобой времена войн Сака с Персами тоже говорят об этом! Дарий ведь людей иной веры, тоже ведь как в исламе, называл НЕВЕРНЫМИ и говаривал, что потому и воюет с ними. Так что ИСЛАМ появился не на пустом месте, и начало его с той же стороны.
      Далее. У ЧХ же первая основная гвардия состояла всего навсего из 15 тысяч человек. И к ним примкнули после первой же крупной победы примерно 100 тысяч воинов. А эти 15 тысяч человек в основном, я думаю, есть БОРДОНЦЫ. Которые под влиянием языка Халха Монголов стали БОРДЖИГИНАМИ. Я уверен в этом.

      0
      • Атас
        1 ноября 2012  

        Да ну...

        Курумы — глыбово-щебнистые накопления на склонах гор различной крутизны, сложенных скальными породами. Они образуют потоки обломочного материала, в плане напоминающие движение рек или ручьев.

        А авторы этих строк сами бывали в Каракоруме (Хархорине)? И откуда они только раскопали такое псевдонаучное объяснение. Хархорин стоит бувально на камнях. Русло реки Орхон -- сплошная каменная канава. Притом, камни все темного, черного цвета. Настоящее ХАРА КУРУМ. Междупрочим, у нас тоже есть своего рода Каракорум. Старое название поселка Бэтинчэ Ленского улуса -- Курум. Там течет река Нүүнэ, тоже "каменная" река.

        0
      • гыгы999
        1 ноября 2012  

        Информация к размышлению ... - leonid *

        http://www.sitc.ru/nasled/writer/HTML/kseno.htm

        0
  • гыгы999
    1 ноября 2012  

    Вот время тоже совпадает.

    Скрытый текст
    Кюль-тегин
    [править]Материал из Википедии — свободной энциклопедии
    Кюль-тегин

    Принц (тегин) Второго тюркского каганата

    Рождение:    685 год
    Смерть:    27 февраля 731
    Кюль-тегин (Kül (Köl, Gül, Göl) Tigin (Tegin)[принц Кюль] Khan Bengü İnançu Apa Tarkan), 闕特勒 (685 — 27 февраля 731), политический и военный деятель Второго тюркского каганата, соправитель Бильге-кагана, сын Кутлуг-Эльтериш-кагана.
    [править]Биография

    Прославился как героический воин и участник множества военных походов, обеспечивающих тюркам гегемонию в Центральной Азии.
    В 710 вместе с Тоньюкуком и Могиляном вторгся с тюркской армией в Хакасию, нанеся поражение кыргызам.
    В 716 предотвратил переворот и посадил на тюркский трон своего брата Могиляна (Бильге-кагана).
    В его честь был создан обширный погребальный комплекс, важную часть которого составил ряд балбалов — изображений поверженных противников, главным из которых был кыргызский Барс-каган.
    Эпитафия Кюль-тегину — памятник тюркской рунической письменности VIII в. — найдена в 1889 Н. М. Ядринцевым в долине Кошо-Цайдам, на берегу р. Орхон (Монголия). Надписи дешифрованы в 1893 году датским учёным профессором Вильгельмом Томсеном. Памятник содержит ценные исторические сведения и даёт богатый лингвистический материал.

    балбалов-балбах-побежденные враги.
    Хакас-Һака ууһа буолон сөп.
    Скрытый текст
    Курыканы — общность на территории Сибири и Центральной Азии, упоминавшаяся в древнетюркских рунических надписях VII—VIII веков н. э. В ряде случаев в надписях фигурирует выражение уч курыкан, то есть «три курыкана», что обычно интерпретируется как союз трех племен, объединенных названием курыкан. Считаются предками саха (якутов) и хори (бурят).
    В большой надписи орхонским руническим письмом на памятнике Кюль-тегину уч-курыканы перечислены в составе десяти народов и государств (Бёклийская степь, табгачи, тибетцы, авары, Рим, кыргызы, уч-курыканы, отуз-татары, кытай и татабы), приславших своих представителей на похороны первых тюркских каганов. В той же надписи при изложении событий, последовавших после распада первого Тюркского каганата, говорится уже о курыканах (без «уч») как о врагах. В надписе енисейским руническим письмом в Уйбате говорится: «когда брали народ курыкан».
    [править]Китайские упоминания народа гулигань

    В китайских летописях и поэзии VII-IX веков отмечены многочисленные упоминания народа гулигань, чье название обычно считается китайской передачей термина курыкан. По китайским данным гулигань проживали вблизи "северного моря", под которым чаще всего понимается оз. Байкал. "Строевого войска" гулигань имели пять тысяч человек. Управлял народом правитель с титулом сыцзинь, интерпретируемым как китайская форма тюркского титула тыгин. В одном упоминании говорится, что "в стране гулигань двое сыцзинь живут вместе". В связи с гулигань неоднократно упоминается особая порода лошадей, которые "с головы походили на верблюда". Сохранилась небольшая поэма, сочиненная танским императором и посвященная лошадям, подаренным гулиганьскими послами. По мнению А.П. Окладникова, эта порода происходила от лошадей Средней Азии и Ближнего Востока.

    Курханнар эрэ халбыттар.

    0
    • Атас
      1 ноября 2012  

      Интересно

      ...БОРДЖИГИДАЙ Мэрген его жена монголдЖИН Гоа...
      Где-то я там наверху повесил отрывок из древнего якутского алгыса, написанного Линденау в 1740-х годах. Там тоже была некая МУНГАЛДЬЫН ХОТУН (кажется было Муҥу булларбыт Муҥалдьын хотун...)

      0
    • гыгы999
      3 ноября 2012  

      ))) Үс-Курыкан и есть потомки племен САКА.

      В истории все перевернуто приходится корректировать))).

      0
  • гыгы999
    1 ноября 2012  

    Тенгранцы

    Цитата:
    Древнетюркское руническое письмо (орхоно-енисейская письменность) — письменность, применявшаяся в Центральной Азии для записей на тюркских языках в VIII—X вв.
    Орхоно-енисейская письменность обслуживала единый литературный язык (наддиалектный койне) того времени[источник не указан 173 дня], который обычно называется языком орхоно-енисейских надписей[источник не указан 173 дня]. Выделяются 7 групп: ленско-прибайкальская, енисейская, монгольская, алтайская, восточно-туркестанская, среднеазиатская, восточно-европейская[1]. Соответственно, они принадлежат племенному союзу курыкан, Кыргызскому каганату, Восточно-тюркскому каганату, Западно-тюркскому каганату, Уйгурскому каганату в Монголии, Уйгурскому государству в Восточном Туркестане, булгарам, хазарам и печенегам.
    Названия даны: 1) по форме знаков, напоминающих германские руны; 2) по местам находок в долине Орхона (Второй тюркский каганат) и верховьях Енисея (Кыргызский каганат).

    Пример чтения

    Текст не отразился — отрисовка (направление письма справа налево)
    T²NGR²I — транслитерация (эпиграфическая)
    teñri — транслитерация (современная тюркская латиница)
    /teŋri/ — транскрипция МФА

    ВОТ НАШИ ЕДИНОВЕРЦЫ, КОТОРЫЕ ВЕРНЫ ЕДИНОМУ БОГУ ТАҥАРА!

    0
  • Атас
    1 ноября 2012  

    Могул, не печалься

    Но человек моего уровня знания языка сломает ноги, пытаясь понять что же это такое!
    И чего только стоят имена БЭЛГИНЭТЭЙ, БУГУНАТАЙ и тогдалия.

    Да ничего там сложного нет, ты просто раньше не интересовался морфологией. Просто достань где нибудь грамматику монг. и эвенк. языка, и все станет на свои места. Станешь спецом. Тюркскую морфологию изучать смысла нет, там почти то же самое, что и у нас. Ты просто боишься окончаний. Вот даже я не подглядывая никаких словарей могу дать приблизительный перевод. И ни один великий филолог, академик не может все это оспорить. У монгольских языков окончание -ТАЙ все равно что наше -ЛААХ. То есть, прилагательное. Поэтому механически выбрасываешь их. Остается БЭЛГИНЭ и БУГУНА. Абсолютно убежден, что -НЭ и -НА -- словообразующие морфемы, остается БЭЛГИ и БУГУ. БЭЛГИ на всех тюркских и монгольских, в том числе и на якутском, означает ПРИМЕТА, ЗНАНИЕ, МУДРОСТЬ. А БУГУ, скорее всего, БЫК. Т.е. сильный и могучий как бык (у тюрков БУҕА, у монголов БУХА, даже у русских БУГАЙ).
    Получается: БЭЛГИНЭТЭЙ -- МУДРЫЙ, БУГУНАТАЙ - СИЛЬНЫЙ БЫК. Все просто.

    0
    • Оidоv
      2 ноября 2012  

      БэлгунуТЭЙ , моя описка , правильно БэлгунуТАЙ .

      Если читать буквально , БУГУнуТАЙ - родственник Бугу (Хатаги ) , по матери . Или же БУГУНУ - бормочущий . Второе проще -имя Бэлгу , родственник по матери , видать старались дать имя знаменитых предков . Имя знаменитого Бэлгу , знает Оффен .

      0
  • гыгы999
    1 ноября 2012  

    Это были письмена-руны САКА в V—III вв. до н. э. по времени совпадает.

    Скрытый текст
    История письма

    Близкие к древнетюркскому письму надписи V—III вв. до н. э. обнаружены в Казахстане — (Иссык — см. иссыкское письмо) и Киргизии — Талас, Балыкчи и др.


    Орхонская надпись на камне в городе Кызыл
    Происхождение письма неясно. Отмечают совпадения многих знаков с тамгами, с возможным акронимическим происхождением звуковых значений. Сходство некоторых знаков (а также общий угловатый стиль, направление письма, совпадение фонетических значений), позволило предположить родство с ранними видами семитской письменности: библейской и финикийской.
    По предположению ряда учёных, тюркские руны были созданы около начала VIII века на базе согдийского письма, возможно, с добавлением знаков из других алфавитных систем, путём трансформации курсивных начертаний букв в геометризованные формы. Предлагались также гипотезы о происхождении из фонетических знаков китайского письма, либо письма кхароштхи (или наличие, по крайней мере, общего корня).
    Ко временам монгольского нашествия (XIII век) алфавит был вытеснен арабицей под мощным арабо-мусульманским давлением и другими видами письма тюркских народов.

    Цитата:
    По предположению ряда учёных, тюркские руны были созданы около начала VIII века на базе согдийского письма

    Согдийцы это предки узбеков, только они земледельцы или полукочевые народы. Слово ТЭНГЭ (равенство) и у них и у нас одинаково переводится, больше у тюркоязычных в словарях похожего не нашел (Это из моего топа-"Откуда пошли деньги"). Так что у САКА письмена оказывается более древнее, чем предполагали ученые (V—III вв. до н. э. сходятся местоположение и время племен САКА).
    сурааһын
    I линия, черта; көнө сурааһын прямая линия; токур сурааһын кривая линия; сурааһынна тарт = чертить линию.
    II и. д. от сураа = осведомление, запрос о ком-чём-л.

    0
    • Оidоv
      2 ноября 2012  

      Видать родству , к

      Например : БЭЛГУнуТАЙ . Видать предки знали , что " хромосома " матери очищает от тяжелых наследственных болезней . Это подтверждает , что их предки , знали основы христианства - НЭРИЭТНИК (ЕРЕТИК ). А также " принадлежность " к "знаменитостям " , независимо к тюркам , монголам или тунгусам , оберегало их род .

      0
      • Могул
        2 ноября 2012  

        Оidov

        Да, слово НЭРИЭСПЭ применялся совсем недавно очень часто. И именно в смысле какого то иноверия. И если не забыл, в родословной ЧХ были люди типа ХАЛЫЙ, ХАБЫЧЧА. А у нас как раз имеется род ХАБЫЧЧА (ХАБЫЧЧАЛАР). А ХАЛЫЙ был другом моего отца. Был также ХАБЫЧЧА бөҕө, или ХАБЫККА бөҕө.
        И вообще то народ должен помнить свое начальное начало. Например, был у нас КАРАКААН, ЭЛЛЭЙ, О(!)МО5ОЙ, ТЫГЫН, ЧЫҥЫС ХААН, ОДУН ХААН; - и ВСЕ! И как там потомки потом будут интерпретировать эти имена не важно! Ведь человек сначала приобретает ИМЯ и затем начинает фантазировать о своей жизни всякое, в зависимости от ситуации, конечно... Так же и народ, я думаю...

        0
        • Оidоv
          2 ноября 2012  

          Впоследствии у ЧХана , был брат из Урянхайского племени .

          Имя , его было , тоже БэлгуТай . Может ошибаюсь - давно читал .

          0
  • болт
    2 ноября 2012  

    это значит он был

    из рода саха-шашлычников? вот оказывается чем предки промышляли

    0
    • Оidоv
      2 ноября 2012  

      Болт , видать не улавливаешь сути .

      Гыр - Гыр , говорит , что предки тюрков и монголов , разделились давно . Одни стали мусульманами , другие христиане - несторианцы и Тенгри , или не так понял ? Предок Огу3 был ближе к Олонхо , по учению . Вообще , у древних людей , было меньше предрассудков , по цвету кожи и т.д .

      0
  • гыгы999
    2 ноября 2012  

    Вот нашел Карпини на латинском языке и перевод онлайн сделал.

    Скрытый текст
    De initio imperij siue Principatus eorum. Cap. 8.

    [Tartariæ populi.] Terra quidem ilia Orientalis, de qua dictum est suprà, quæ Mongal nominatur, quatuor quondam habuisse populos memoratur. Vnus eorum Yeka Mongal, id est, magni Mongali vocabantur. Secundus Sumongal, id est, aquatici Mongali, qui seipsos appellabant Tartaros, à quodam fluuio per eorem terram currente, qui Tartar nominatur. Tertius appellabatur Merkat. Quartus verò Metrit. Omnes vnam personarum formam et vnam linguam habebant hi populi, quamuis inter se per Principes ac prouincias essent diuisi. [Chingis ortus et res gestæ.] In terra Yeka Mongal quidam fuit, qui vocabatur Chingis. Iste coepit robustus venator esse: didicit enim homines furari, et prædam capere. Ad alias terras ibat, et quoscunque poterat, captiuabat, sibíque associabat. Homines quoque suæ gentis inclinauit ad se, qui tanquam Ducem sequebantur ipsum ad malè agendum. Coepit autem pugnare cum Sumongal, siue cum Tartaris, et Ducem eorem interfecit, multòque bello sibi Tartaros omnes subiecit, et in seruitutem redigit. Post hæc cum istis omnibus contra Merkatas, iuxta tenam positos Tartarorum pugnauit, quos etiam bello sibi subiecit. [Naymani. Infra cap. 25.] Inde procedens contra Metritas pugnam exercuit, et illos etiam obtinuit. Audientes Naymani, quòd Chingis taliter eleuatus esset, indignati sunt. Ipsi enim habuerant Imperatorem strenuum valdè, cui dabant tributum cunctæ nationes prædictæ. [Fratres discordantes oppressi.] Qui cùm esset mortuus, filij eius successerunt loco ipsius. Sed quia iuuenes ac stulti erant, populum tenere nesciebant, sed ad inuicem diuisi ac scissi erant. Vnde Chingi prædicto modo iam exaltato, nihilominus in terras prædictas faciebant insultum, et habitatores occidebant, ac diripiebant prædam eorum. Quod audiens Chingis, omnes sibi subiectos congregauit. Naymani et Karakytay ex aduerso similiter in quandam vallem strictam conuenerunt, et commissum est prælium, in quo Naymani et Karakytay à Mongalis deuicti sunt. Qui etiam pro maiori parte occisi fuerunt, et alij, qui euadere non potuerunt, in seruitutem redacti sunt. [Occoday Cham.] In terra prædictorum Karakytaorum Occoday Cham, filius Chingischam, postquam imperator fuit positus, quandam ciuitatem ædificauit, quam Chanyl appellauit. [Homines syluestres.] Prope quam ad Meridiem est quoddam desertum magnum, in quo pro certo syluestres homines habitare dicuntur, qui nullatenus loquuntur, nec iuncturas in cruribus habent, et si quando cadunt, per se surgere non valent. Sed tamen discretionem tantam habent, quod filtra de lana Camelorum quibus vestiuntur, faciunt et contra ventum ponunt. Et si quando Tartari pergentes ad eos vulnerant eos sagittis, gramina in vulneribus ponunt, et fortiter ante ipsios fugiunt.

    Скрытый текст
    О начале своей империи или княжеств. Глава 8.

    [Из людей из Татарии.] Восточный Кантри, о котором говорится aboue, который называется Mongals, четыре sortes людей. Yeka Mongals Один из них, то есть великого Mongals называли. Вторая компания была названа Sumongal, то есть, вода Mongals, которые сделали сами себя называли татарами, riuer certaine, проходящей через их countrey, который назвал татарина. Третий называется Merkat. Четвертый Metrit. Все эти люди имели один язык и набор формы лица, хотя они были разделены друг от друга князьями и провинциями. [Чингис родился и его поступки.] В стране Yeka Mongals Существовал определенный, он, что называется Чингис. Этот человек стал великим охотником он узнал мужчин, чтобы украсть, чтобы поймать добычу. В других странах он пошел, и всех, кого он мог captiues, она велела им знать, связанных с. Мужчины тоже своего народа, колебался, vnto него, кто последовал за ним, как их Captaine и не couragiously предстоит сделать. Компания была названа Sumongal Тогда он начал войну с ним или с татарами, и он предан смерти их лидера, сам войне гораздо быстрее, чем татары покорили всех, и в рабство. После этих событий, все мы дело с этими Merkatas с другой стороны, в соответствии с громом набор для татар, которых той же войны и покорил. [Naimani. Под крышкой. 25.] Исходя из оттуда, сражался против Metrites, и завоевал их также. Слушание Naimani, это будет то, что Чингис был поднят в таком случае, они были возмущены. Для них была могучей и могущественной Emperour, которому они дали дань вышеназванных народов будут все семьи. [Раздор среди братьев.] Когда он умер, его sonnes, сменил его в свои. Но, будучи молодыми и глупыми, они не знают, как держат в руках народа, а друг с другом, потряс, и были распределены следующим образом. После чего, манера вышесказанное, Ching уже были сняты, они, тем не менее, сделал нападение на землях вышеупомянутого, может, и положил жителей и грабили своих жертв. И когда она услышала о Чингис, собрал все свои subiects. Точно так же сосредоточено в узкой долине и Naimani Karakytay оппозиции, и началась битва, и в котором Naimani Karakytay Mongals родом. Те, кто был предан смерти, тоже, по большей части, и остаток, который не мог убежать, в рабстве. [Occoday Хама.] В стране вышеупомянутые Karakytaorum Occoday Хама, сына Чингис-Хана, после того, как император был помещен, строятся certaine citie, который он назвал Chanyl. [Мужчины дикой природе.] С южной стороны, под рукой, которая является своего рода огромная пустыня, в которой они сказали, чтобы жить для некоторых диких людей, которые ни в коей мере они говорят, в суставах ног, не имеют они, и если они падают, они не могут подняться сама по себе. Но, тем не менее, у них есть такое усмотрение, что шерсть верблюдов фильтры, которые одеты, и они делают против Winde. И если в любое время татары преследовали их ранить их со своими стрелами, и они положили в раны травой, и они также сильно, прежде чем они убежали.

    Карпини вроде отождествляет Найманов с Каракитаями? В русском переводе они союзники. После победы над ними Чингизхан делает императором своего сына ОККОДАЙ ХАНА (не УГЭДЭЙ оказывается). В русском переводе certaine citie - построил город ОМЫЛЪ, потом я вторично слово certaine citie перевел с латинского с другого сайта -урегулирован быстро, все равно город вроде, но название иное чем в русском переводе ЧАНЫЛ.
    riuer certaine-изобилует определенных

    0
    • гыгы999
      3 ноября 2012  

      Предположу этимологию имени Угэдэй, Оккотдай.

      ЫГАТУУЙ - крепко души. Подходящее имя для ХАНА.
      ыга
      нареч. 1) крепко, плотно; ыга тут= крепко сжать; ыга сим= плотно набить. (напр. мешок); 2) перен. очень, сильно; ыга куттан = сильно испугаться # ыга үктээ = заставить силой, насильно, против воли (делать что-л.); ср. ыбылы.
      ИГО возможно происходит от нашего слова ЫГА.
      тууй=
      1) душить, затруднять дыхание; кинини сөтөлө тууйар его душит кашель; 2) перен. мучить, тяготить; давить; кининк ыар санаалар тууйаллар его давят тяжёлые мысли; 3) перен. зажимать, душить что-л.; кириитикэни тууй = зажимать критику; көҥүлү тууй = душить свободу.

      0
  • гыгы999
    2 ноября 2012  

    Не пропускают меня уже.

    0
  • гыгы999
    2 ноября 2012  

    Посмотрел Рубрука на латинице, так у него Монголы-МОАЛЫ, хотя есть Мангу -хан.

    Хотел поставить латинский текст и перевод, но не проходит сообщение.
    Рубрук посетил Каракорум через 7 лет после Карпини.
    МОНГОЛЫ у Рубрука МОАЛЫ, почему так? Скорее всего звук буквы ҕ- Крапини воспринял как словосочетание НГ, а Рубрук его вообще упустил, причем Мэҥэ-хана Рубрук так и назвал Mangu Can.
    Моҕол скорее всего так себя называли предки нынешних Монголов.
    Якутско-русский словарь:
    Моҕол
    уст. 1) большой, внушительный, солидный
    Мэҥэ
    Словарь Пекарского:
    [ср. др.тюрк. мэҥгү, бур. мөнхө (мүнхү, мүнкү, мүнхэ), монг. мөҥкө - вечный] =мэгэ, мөҥө (мөгө), мөҥү, мэҥии, (мэги), мэҥиэ;
    непреходящий, вечный;
    большой обширный, пространный Б.; мэҥэ таҥара неизмеримое небо Б. (=мэҥэ халлаан );
    небо, местопребывание Бога;

    0
  • гыгы999
    2 ноября 2012  

    Путешествие Рубрука 1253 г.

    image

    0
  • гыгы999
    2 ноября 2012  

    Карта путешествия Карпини 1246 г.

    image

    0
  • гыгы999
    2 ноября 2012  

    Восточно-тюркский каганат

    Скрытый текст
    Восточно-тюркский каганат — государство кочевых[источник не указан 954 дня] тюрков. В 603 году произошёл распад Тюркского каганата на Западный и Восточный. Каганат имел общие протяжённые границы с Китаем и вёл частые войны с этим государством. Не раз отстаивал свою самостоятельность в крупных сражениях со своим южным соседом. Несколько крупных сражений, в которых каганат одержал победы, произошли в конце VII века и в первой половине VIII века.
    Танская империя захватила Восточный каганат в 630 году.
    Произошло восстание кок-тюрков во главе с Кутлугом в 682 году и восстановление Восточного каганата под именем Кок-Тюркский каганат. Кутлуг разгромил китайские войска в Синьчжоу в 686 году. Набег Мочура на Линчжоу в 694 году. Вторжение Мочура в Китай и разгром имперских войск в 698 году.
    После поражения в 745 году в битве с уйгурами под предводительством хана Моюн-Чура, на землях Восточного каганата возник Уйгурский каганат, просуществовавший с 745 по 840 годы.
    Каганы восточно-тюрского каганата
    Имя    Годы Правления    Тюркское Тронное Имя[1]    Тюркское Личное Имя[1]    Китайское Тронное Имя
    Жангар Киминь-каган    603-608    Киминь-каган    Жангар    кит. упр. 启民可汗, пиньинь:qiminkehan —Циминькэхань
    Шибир-хан Тюрк-шад    608-619    Шибир-хан    Тюрк-шад    кит. упр. 始畢可汗, пиньинь:shibikehan —Шибикэхань
    Чуло-хан Силиг-бег-шад    619-620    Чуло-хан    Силиг-бег-шад    кит. упр. 處羅可汗, пиньинь:chuluokehan —Чулокэхань
    Кат Иль-хан Багадур-шад    620-630    Кат Иль-хан    Багадур-шад    кит. упр. 頡利可汗, пиньинь:xielikehan-Селикэхань

    Под властью ТАН
    После разгрома каганата Ли Шиминем, император решил разделить захваченные тюркские земли на два губернаторства: Динсян и Юньчжун, которые управлялись китайскими наместниками, тюркские ханы стали средним и низшим звеном управления. Тем не менее, на востоке был оставлен аймак толосов (также там проживали кидани) под управлением лояльного Китаю Толис-хана.
    Толис-хан Шибоби (630—631)
    Толис-хан Хэлоху (631—639)
    Мятеж тюрок переселённых в Китай вынудил Тай-цзуна Ли Шиминя выселить тюрок из Китая и передать их под управление Ашина Сымо, назначенного ханом:
    Иминишусыликэхань (639—644)
    Ильчур Кюбэ-хан (644—649)
    Покорённые тюрки были разделены на два наместничества с назначаемыми чиновниками-правителями. Около 30 лет тюрки жили довольно мирно, но были угнетаемы китайцами.
    В 679 роды Выньфу и Фыньчжи подняли восстание, к ним примкнули почти все тюрки. По началу восставшие имели успех и разгромили китайскую карательную армию. Танский генерал Пэй Хин-кянь разбил тюрок у горы Хэйшань. Выньфу и Фыньчжи временно сложили оружие, но потом возобновили войну. Во главе тюрок встал хан Фунянь. Китайцы вновь были разбиты, но Фунань быстро поссорился с выньфу и другими родами. Генерал Хуай Шунь пытался уничтожить Фуняня, но тот сражался очень храбро и поход Шуня провалился. Совместными действиями Хин-кяня и Шуня Фунань был зажат и потерял обоз. В 681 он был вынужден сдаться Пэй Хин-кяню вместе с другими восставшими. Тюркютов привезли в Чанань и отрубили им головы.
    Несмотря на гибель большинства старейшин, тюрки были готовы продолжить борьбу. В 682 году тюркютов возглавил Ашина Кутлуг.

    Каганы Кок-Тюркского каганата
    Имя    Годы Правления    Тюркское Тронное Имя[1]    Тюркское Личное Имя[1]    Китайское Тронное Имя    Китайское личное Имя    Титулы[1]    Примечания[1]
    Эльтериш каган    682-693    Елтеріс білге қаған    Құтлық    кит. упр. 颉跌利施可汗, пиньинь:xiedielishikehan —Седиэлишикэхань    кит. упр. 阿史那骨篤祿, пиньинь:ashinagudulu — Ашина Гудулу    Тутун — офицерский чин    Гудулу — устаревшее китайское, Кутлуг — счастливец.
    Капаган каган    693-716    Kapağan Kağan    Мочур    кит. упр. 迁善可汗, пиньинь:qianshankehan —Цяньшанькэхань    кит. упр. 阿史那默啜, пиньинь:ashinamochuo — Ашина Мочо    нет    Капаган хан — хищный хан
    Богю каган    716    İnel Kağan(?)    Богю    кит. упр. 拓西可汗, пиньинь:tuoxikehan -Тосикэхань    кит. упр. 阿史那匐俱, пиньинь:ashinafuju — Ашина Фуцзюй    малый хан    Тоси — расширитель запада
    Бильге-хан Богю    716-734        Богю    кит. упр. 毗伽可汗, пиньинь:pijiakehan — Пицзякэхань    кит. упр. 阿史那默棘連, пиньинь:ashinamojilian — Ашина Моцзилянь    нет    Бильге-хан — «Мудрый хан; герой»
    Йоллыг-тегин Ижань-хан    734-739    Yollyg-Tegin Izhan-Kağan    Ижань    кит. упр. 伊然可汗, пиньинь:yirankehan — Ижанькэхань    кит. упр. 阿史那伊然, пиньинь:ashinayiran — Ашина Ижань    нет    нет

    image

    image

    0
    • гыгы999
      2 ноября 2012  

      Фиолетовый цвет- Западно-тюркский каганат: Светлая область - прямое управление, темная - сфера влияния. Синий цвет-Восточно-тюркский каганат: Светлая область - прямое управление, темная - сфера влияния.

      0
  • гыгы999
    2 ноября 2012  

    Уйгурский каганат

    Скрытый текст
    Уйгурский каганат — государственное образование первой половины первого тысячелетия новой эры, пришедшее на смену Восточно-тюркскому каганату.
    Имело три независимых объединения.
    Первый, самый ранний каганат, был создан в Хангае в 323 году и просуществовал около 200 лет.
    Второй каганат появился в 523 году и просуществовал чуть более 80 лет. Был уничтожен Тюркским каганатом в 603 году.
    Через 140 лет появился третий Уйгурский каганат на территориях бывшего Восточно-тюркского каганата.
    В 840 году это государство было уничтожено после двадцатилетней войны енисейскими кыргызами. Под натиском кыргызов уйгуры откочевали на юг в Восточный Туркестан. Очаги их государственности продолжали существовать на западе Ганьсу и в Турфанском оазисе.
    Было принято общее для всех название — уйгуры. Третий уйгурский каганат был феодальным государством с первыми признаками оседлости у уйгуров. Там были развиты скотоводство, земледелие, а также ремесла и промыслы, развивалось строительство городов и крепостей. Как и в случае с предыдущими тюркскими каганатами, столичные функции выполняла долина Орхона (города Хара-Балгас и Бешбалык). Несмотря на то, что материальная культура уйгуров имеет глубокие центрально-азиатские корни, именно уйгуры начали всерьёз насаждать в центрально-азиатских степях оседлую цивилизацию[1].
    Первые упоминания
    Уйгуры ( кит. упр. 回鹘, пиньинь: huihu, палл.: Хуэйху, чаще Хойху) впервые упомянуты в летописях эпохи Северной Вэй (354—386). Считалось, что они произошли от Хуннов. Также их называли кит. упр. 高車, пиньинь: gaoju, палл.: Гаоцзюй — дословно «высокие телеги», за их обычай ездить на телегах с высокими колёсами. Они входили в племенной союз называвшийся кит. упр. 敕勒, пиньинь: chilei, палл.: Чилэй. Данное название китайские историки считали правильным, в отличие от кит. упр. 鐵勒, пиньинь: tiele, палл.: Телэ — Теле (см. Телеуты, Теленгиты). Во времена Суй их стали называть Уху(烏護), также Ухэ (烏紇), Вейхэ (韋紇). Они жили в Джунгарии и Халхе и делились на 15 племён собственно уйгур, а также союзные племена басмалов и карлуков:
    1. Юаньхэ (袁紇)
    2. Сюеяньто (иногда Сеяньто, сиры)(薛延陀)
    3. Циюй(契羽 или 契亦, киби) Кочуют северо-западнее Харашара по реке Инсочуань (鷹娑川, Хурь-хара-усу(?)), но южнее Доланьгэ. Их старейшина Гелен (哥楞) объявил себя Иучженьмохэкеханем (易勿真莫賀可汗). Он и его младший брат Мохэдотэлэй (莫賀咄特勒), оба были очень храбрыми. После смерти Гелена, его сын Хэлишанню (何力尚紐) вместе с племенем вступил в 632 году в китайское подданство. Севернее Лянчжоу, и Ганьчжоу, им была выделена земля, названная Юсичжоу (榆溪州). В 653 переименована в хэлань дудуфу (賀蘭都督府) и передана в управление Янжань духу (燕然都護, en:Protectorate General to Pacify the North). Хэли верно служил Китаю в мире и в войне. В 827 их земли присоединили к Чжэньу (振武)

    4. Дубо-Тувинцы(都播, 都波) жили у озера Сяохай (小海, вероятно Хубсугул), на западе граничили с хакасами, на юге с другими уйгурами. Делились на три аймака, каждый со своим старейшиной. Кормились восновном охотой и собирательством, жили в шалашах, не знали календаря. Собирали корни растений, ловили рыбу, охотились на зверей и птиц. Богатые носили одежду из шкур соболей и оленей, бедные из птичих перьев. В качестве дара на свадьбах богатые дарили лошдей, а бедные шкуры оленей и коренья. Покойников клали гробы и отвозили их в гору или привязывали на деревьях. Законов не знали, пойманный вор возмещал стоимость украденного вдвойне. В 647 впервые отправили послов Китай и позднее израдка наведовались.
    5. Гулигань-Курыканы (骨利幹). Кочевали к северу от Байкала (瀚海). Около 5000 воинов. В их стране много растёт байхэ (百合, сарана), разводят высоких, сильных и выносливых лошадей. Китайцы считали, что их земли простираются до океана и писали о коротких ночах и длинных днях в землях гулиганьцев. Когда они прислали послов к императору Тан, китайцы отправили в их земли юнь хой цзянзюня (雲麾將軍, сопровождающий третий высший ранг, почётное военное звание) Кан Суми (康蘇蜜). Их земли были преобразованы в округ Сюаньцюе (玄闕州). Старейшина Сыцзинь (俟斤) подарил китайцам много лошадей, 10 из них император отбрал для себя и дал им имена. В 662 году их земли переименовали в округ Юйу (余吾州) и подчинили байкальскому наместничеству (瀚海都督府).
    6. Доланьгэ-Теленгиты (多覽葛) или Долань (多濫) кочуют восточнее Сюеяньто по реке Тунло (同羅水). Около 10 000 войска. В 646, после разгрома Сюеяньто, доланьгэ во главе со старейшиной Сыцзинь Доланьгэ (俟斤多濫葛). Земли их были переформированы в янжань дудуфу (為燕然都督府, генерал-губурнаторство янжань), старейшина возглавил дудуфат и получил чин ю вэй да цзанцзюнь (右衛大將軍, главнокомандующий правой гвардией, основной 3-й ранг). Ему наследовал Доланьгэ Сайфу(多濫葛塞匐).

    7. Пугу или Бугу (仆骨, 仆固) Кочевали восточнее Доланьгэ, это самое северное уйгурское племя. Упорны, отважны, неукротимы. Насчитывали 30 000 юрт и примерно 10 000 воинов. В начале, присоединились к Тюркскому каганату, потом к Сюеяньто. Когда в 645/646 сюеяньтосцы были покорены империей Тан, пугуский старейшина Цюсофу Сылифа Гэлань Баянь (酋娑匐俟利發歌濫拔延) вступил в китайское подданство. Земли пугу были преобразованы в округ Цзиньвэйчжоу (金微州), а старейшина назначен ювуйвэй да цзанцзюньем (右武衛 大將軍 , главнокомандующий правой воинственной гвардией, 3-й основной ранг) и занял пост «дуду» (都督, примерно: генерал-губернатор) своей области. В 713 году в землях пугу случился какой-то мятяж и погиб старейшина, а его убийца сдался китайским властям и был казнён. Сын убитого старейшины, Хуай Энь (懷恩) был в 756—758 назначен Шофанским Цзедуши (朔方節度使), сохранилась его биография.
    8. Баегу-Байырку (拔野古, 拔野固 , 拔曳固) Жили севернее Гоби, восточнее пугу, но западнее мохэ. 60 000 юрт при 10 000 войска. В их стране прекрасные травы, отличные лошади и есть производство железа. В их землях протекает река Кангань (康幹河) в которую кидали на 3 года сосны и доставали их древесину, которая называлась канганьский камень (康幹石) (ср. морёный дуб). Баегу любят охоту и умеют охотятится на оленей на льду озёр, гоняясь за ними на лыжах. Обычаи как у теле, но наречия несколько различаются. В 629 присылали, вместе с другими родами, послов в Китай. В 647 старейшина Сылифа Цюйлиши(俟利發屈利失) подчинился данастии [[Тан (династия)]. Земли были присоединины к дудуфату (都督府, примерно: генерал-губернаторство) Юлин (幽陵), старейшина получил чин ювуйвэй да цзанцзюнь (右武衛 大將軍 , главнокомандующий правой воинственной гвардией, 3-й основной ранг). В 656—660 они бунтовали вместе с другими племенами. Их подавил Чжен Жэнтай (鄭仁泰) главнокомандующий левой воинственной гвардии (左武衛大將軍), старейшина был убит. В 742 пожелали восстановить подданство Тан.
    9. Тунло-Тонгра (同羅) Кочуют севернее Сюеяньто и восточнее Доланьгэ. Способны выставить 30 000 воинов. В 728 отправили посла в Китай. Спусты много лет попросились в китайское подданство. Их земли были преобразованы в «Гуйлиньское дудуфу» (龜林都督府, похоже на генерал-губернаторсво), старейшина Сылифа Шицзяньчо (俟利發時健啜) был назначен цзолинцзюнь дацзянцзюнем (左領軍大將軍, главнокомандующий левой водительствующей армии, 3-й основной ранг). Во время мятяжа Ань Лушаня, тунлосцы были зачислены в его войско, под именьм войска елохэского (曳落河).
    10. Хунь (渾) Самое южное племя. В 630, после свержения тюрок, перекочевали к границы Танской империи, их старейшиной был Сылифа Атаньчжи (俟利發阿貪支). После разгрома Сюеяньто в 646, хуньский старейшина Сылифа Хуньван (俟利發渾汪) переселился в Китай, вместе с племенем. Их земли были разделены на один, затем два Гаоланьских дудуфу (臯蘭都督府). У хунь было два старейшины Атаньчжи и Хуньван. Император склонился к поддержке более родовитого Атаньчжи, Хуньван влагоразумно отказался от поста. Атаньчжи назначен юлинцзюньвэй дацзанцзюнем (右領軍衛大將軍, главнокомандующий правой водительствующей армии, 3-й основной ранг) и начальником округа (刺史) Гаоланьчжоу (臯蘭州). Хуньван получил чин юнхуэй цзяньцзюнь (雲麾將軍, командующий облочного знамени, почётная должность без полномочий, 3-й сопровождающий высший ранг). Атаньчжи наследовал его сын Дашоу (大壽), после него Шичжи (釋之). Шичжи был выдающимся воином, служа у Гэшу Ханя (哥舒翰, en:Geshu Han) он отличился при взятии тибетской крепости Шипучен (石堡城). За храбрость он получил пост ювуйвэй да цзанцзюнь (右武衛 大將軍 , главнокомандующий правой воинственной гвардией, 3-й основной ранг) и княжеское достоинство Жунаньцзюнь гун(汝南郡公, гун области Жунань, 2-й сопровождающий ранг, кормление 2000 дворов, 35 цинов земли в вечное пользование). Служа у Ли Гуанби (李光弼, en:Li Guangbi) при обороне Хэяна (河陽), получил титул ниншоуцзюнь вана (寧朔郡王, Ван области Ниншоу, сопровождающий 1-й ранг, 5000 домов кормления, 50 цинов земли в собственность) и занял пост Шофанского цзедуши (朔方節度). Пугу Хуайэнь (仆固懷恩, en:Pugu Huai'en, генерал-мятежник Ань Лушаня) бежал в Шофан. Шичжи не думал впускать его, но сын его сестры Чжан Шао (張韶) убедил дядю впустить Пугу. Потом Пугу приказал Чжан Шао убить дядю и захватил Шофан. Вскоре Пугу сказал Чжан Шао: «дядю предал, как мне сможешь служить»?. Пугу приказал сломать Чжану ноги и заточить его в темницу. Сянь (瑊), сын Шичжи, служил Тан и ему создали биографию.

    11. В Аде-Эдизы (阿跌) или Хэде (訶咥). В 629, вместе с другими племенами присылали послов в Китай. Земли их были названы округом Цзитянь (雞田州). Где-то между 713 и 741 вышли из подчинения тюркам и перешли в танское подданство. Из этого племени происходят заслуженные военные Гуанцзинь (光進) и Гуанянь (光顏).
    12. Байси (白霫). Занимали бывшие сяньбийскиеземли между Тунло и Пугу. Желая избежать подчинение сюеяньтоо, они осели по реке Аочжи (奧支水) и у гор Ленсин (冷陘山), так что их земли оказались удобно защищены горами со всех сторон. На юге их соседями стали кидани. Могли собрать до 10 000 воинов. Кормились охотой, одежду обшивали красной кожей, женщины носили медные браслеты, полы одежды увешивали бубенчиками. Разделились на три аймака: Цзюянь (居延), Ужомэй (無若沒), Хуаншуй (潢水). Их старейшины звались «сыцзинь» (俟斤) и были верными вассалами Кат Иль-хан Багадур-шад. Два раза присылали послов Тан Тай-цзуну. Позже два их аймака стали китайским округом Нинянь (寘顏州), а другой Цзюянь (居延州), старейшины стали начальниками округов — чиши (刺史). В 660 старейшина Ли Ханьчжу (李含珠) возглавил Цзюянь. Ему наследовал брат Цзюеду (厥都).
    13. Гэлолу (葛邏祿 ,Карлуки). Произошли от тюрок. Кочевали западнее Алтайских гор, по реке Пугучжень (仆固振水, вероятно имеется в виду Тарбагатай в верховьях Иртыша), в из землях горы тянутся с хребтами с севера на юг. По соседству живут Чеби (車鼻). Племя состоит из трёх родов: Моулуо (謀落) или Моуцы (謀刺), Чисы (熾俟) или Пофу (婆匐), Ташили (踏實力). В 650, когда Гао Кань воевал, с Чеби-ханом, вступили в китайское подданство. В 657 их земли были разделены на 3 округа, соответствуя родам: Иншань дудуфу (陰山都督府), Дамо дудуфу (大漠都督府), Сюаньчи дудуфу (玄池都督府). Старейшины стали дуду своих округов. Позже из Дами был выделен округ Цзиньфу (金附州). Похоже положение гэлолу было нестабильным, так как они несколько раз до поддавались тюркам, то свергали их правление. Познее они стали устраивать походы на юг, называя свою орду: «Еху трёх родов (三姓葉護)». Они собрали весьма сильное войско и нанесли поражение тюркам. После 713 дважды присылали послов в Китай. В 742 они объединились с басыми и хойху для войны с Озмыш-тегин-ханом. После гэлолу выступили с хойху против своих бывших союзников басими и принудили их хана бежать в Китай. В 744 поддержали избрание первого кагана уйгура Кутлуга. Впрочем, междё гэлолу не было единства и другие роды избрали себе независимых князей. Много лет спустя гэлолуский старейшина Еху-дун-пига (葉護頓毗伽) схватил тюркского старейшину Абусы (阿布思) и отвёз его в Китай, за что получил титул Цзиньшань-цзюньван (金山郡王). В 742—755 пять раз отправляли послов в Тан. В 756 у гэлолу началась война с другими уйгурами и овладели парой городов. Все контакты с Тан прервались.
    14. Басими (拔悉蜜, Басмалы). В 649 отправили послов к Танскому двору. В 742 басими и союз уйгур уничтожили тюркского Озмыш-тегин-хана. Басими сочли себя независимыми от тюрок и избрав старейшину Хэла-пига-кэханем (賀臘毗伽可汗, тюр. Бильге-хан), отправили послов с подарками к Танскому двору. Тан Сюань-цзун одарил их пурпурными расшитыми халатами, золотыми шпильками, поясами, шагриновыми сайдаками (魚袋, или поясными сумками для верительных бирок). Через три года каганат басмалов был разгромлен союзом уйгуров и карлуков-гэлолу, в результате чего басмальский Бильге-хан бежал в китайское наместничество Бэйтин и поступил на службу Тан и получил звание цзо ву вэй цзянцзюнь (左武衛將軍, левой воинственной гвардии командующий, ранг 3-й сопровождающий).
    15. Хусюэ (斛薛). Кочуют к северу от Доланьгэ. Около 10 000 воинов.
    16. Сыцзе (思結). Кочуют на землях прежде занимаемых сюеяньто.
    17. Сицзе (奚結). Кочуют севернее Тунло. Вместе с сыцзе 20 000 воинов.
    Также были малые роды/племена не обладавшие политической значимостью. Улохунь (烏羅渾, 烏洛侯, 烏羅護) на правом берегу Аргуни по обычаям сходны с мохэ. Увань (烏丸) или Гувань(古丸) и Цзюй(鞠) или Цзе (祴) жили на северо-восток от Баегу. Разводили оленей (鹿), шили из их шкур одежду жили в общих низких бревеньчатых домах. Ююйчже (有俞折) похожи на Баегу. Мало лошадей и овец, но много соболей. Бома (駁馬) или била (弊剌) и элочжи (遏羅支) жили на севере от тюрок. Пашут землю, около 30 000 воинов. Воевали с енисейскими киргызами-хагасами. Брили головы налысо и носили берястеные шляпы. Делали дома из стволов деревьев связывая их между собой берестой. Управлялись отдельными старейшинами. Дахань (大漢) — сильные и рослые люди разводили овец и лошадей на озере Цзяньхай (劍海). В 627—655 китайцы имели кратковременное сообщение с этими племенами, когда они привозили лошадей и соболей.
    [править]Обычаи
    Первоначально политическая организация у Уйгуров была не развита. Каждая семья кочевала отдельно, власть старейшин была слабой. Уйгуры славились как отличные лучники, но склонные к грабежам. Многие уйгуры служили Тюркскому каганату в качестве воинов и «тюрки их силами геройствовали в пустынях севера» (突厥資其財力雄北荒).
    [править]Война с Тюрками
    В 606 году несколько сотен уйгурских старейшин были казнены тюрками. Уйгуры вышли из состава каганата и сплотились вокруг ханского рода Яологэ — 藥羅葛, по реконструкции Хамильтона: Яглакар[2]. Ставка орды была помещена у реки Селенга. У Уйгур было 50 000 строевых воинов, 100 000 семейств всего. Они разводили овец.
    Ханская власть была не очень крепкой. Первым ханом стал Шыгянь Сыгиня (не из рода Яологэ). Когда он умер, ему наследовал сын Яошы Пуса, который стал править совместно с вдовствующей ханшей Улохунь. В 628 Кат Иль-хан Багадур-шад послал 100 000 тюрок во главе с Толис-хан Шибоби против уйгуров. У горы Мацзуншань произошла битва между 100 000 тюрок и 5 000 уйгуров Пусы. К Пусе присоединился род Сеяньто и Пуса перенёс ставку на реку Дуло. В 629 уйгуры отправили посольство с подарками к китайскому двору.
    После смерти Пусы в 629 уйгурами стал править Хулу Сылифа Тумиду. Он разгромил сеяньто и пересеча Хуанхэ в Ордосе, отправил посла в Тан к Ли Шиминю с просьбой принять его в подданство. Император согласился. Ко двору Тан стали прибывать телеские старейшины и говоря, что с падением тюрок в степи воцарилось безвластие и будет лучше признать власть Тан.
    [править]Под властью Тан
    Решением Тай-цзуна Ли Шиминя Уйгуров приписали к губернаторству Ханьхай (瀚海). Другие племена также были поделены между губернаторствами. Чиновниками этих губернаторств были назначены старейшины. Они получили титулы дуду[3] (都督), цыши[4] (刺史), чжанши[5] (長史)、 сыма[6] (司馬). Управление северными землями было передано Яньжань Духуфу[7] (燕然都護府). Ли Су (李素) был назначен управляющим присоединёнными землями — Яньжань Духу[8] По приказу императора в присоединённых землях были построены 68 постоялых дворов со сменными лошадьми, едой и питьём. Хан Хулу Сылифа Тумиду продолжал править уйгурами. Угэ, племянник Тумиду, решил совместно с ханшей и некоторыми другими родичами, свергнуть Тумиду и присоединиться к Ильчур Кюбэ-хану. Собрав воинов, Угэ ночью напал на Тумиду и убил его. Юань Личэнь, помощник Ли Су, объявил Угэ, что император сделает его своим наместником на севере. Обрадованный Угэ приехал к Юань Личэню, который отрубил хану голову. Цуй Дунли, глава военной палаты, был отправлен в северные земли для усмирения кочевников. Тумиду был с почестями похоронен, а на его место назначен сын Пожунь.
    Когда Халлыг Ышбара-Джагбу хан захватил Бэйтин (северное наместничество, точное местоположение неизвестно), 50 000 уйгуров во главе с Пожунем отбили его. В долине Или (река) уйгуры совместно с китайцами разгромили армию Ашина Хэлу. Вскоре Пожунь был повышен в чинах и отправлен на войну с Кореей. Пожуню наследовал его сын Били (比栗). Его правление было спокойным, зафиксированы некоторые территориальные изменения в уйгурских землях.
    После его смерти стал править его сын Дуцзечжи (獨解支). Когда Капаган каган стал возвращать себе утраченные тюрками земли, часть уйгур переселилась в Ордос, там их зачислили в имперскую армию.
    После Дуцзечжи, стал править его сын Фудифу (伏帝匐) стал ханом. Уйгуры вели войну с тюрками и продолжали переселяться в Ордос. Чэньцзун (承宗), сын Фумиду, стал править после смерти отца. По доносу Ван Гюньчо, губернатора Ляньчжоу, Чэньцзун был лишён чинов и умер в ссылке.
    Уйгурский князь Хушу (護輸), в чине сыма, поднял восстание. Ван Гюньчо отправился на запад, на войну с тибетцами, Хушу с уйгурами подстерёг и убил его в 727. Хушу не смог удержать власть и бежал к тюркам.
    Сын Хушу, Гули Пэйло (骨力裴羅) стал править Уйгурами. Он объявил себя независимым правителем и объединившись с карлуками и басмалами разгромил Усу-хана. В 744 Пэйло напал на басмальского Цзедеиши кагана (頡跌伊施可汗) и обезглавил его. В 745 он объявил себя Гудулупигацюэкэханем (骨咄祿毗伽闕可汗). Император признал его и наградил титулом И-ван (義王).
    Каганы 3-го Уйгурского каганата
    Имя    Годы правления    Тронное имя на китайском    Личное имя на китайском    Титул на китайском    Имя на тюркском[9]
    Кутлуг I Бильге Пэйло    744 — 747    кит. упр. 怀仁可汗, пиньинь:huarenkehan, палл.: Хуажэнь-кэхань    кит. упр. 骨力裴罗,пиньинь: gulupeiluo,палл.: Гули Пэйло    кит. упр. 骨咄禄毗伽阙可汗, пиньинь: gudulupigaquekehan,палл.: Гудулупигацюэкэхань    Qutluğ—Bilgä Kül Qağan
    Моян-чур    747 — 759    кит. упр. 英武可汗, пиньинь:yingwukehan, палл.: Ину-кэхань    кит. упр. 磨延啜立,пиньинь: moyanchuo,палл.: Мояньчо    кит. упр. 葛勒可汗, пиньинь: geleikehan, палл.: Гэлэйкэхань,    Bilgä Kül Qağan
    Идигянь    759 — 780    кит. упр. 牟羽可汗, пиньинь:moyukehan, палл.: Моюйкэхань    кит. упр. 移地健,пиньинь: yidijian, палл.:Идицзянь    нет    Tängri Qağan
    Дуньмага    780 — 789    кит. упр. 长寿天亲可汗,пиньинь:changshoutianqingkehan, палл.:Чаншоутяньцинкэхань    кит. упр. 移地健,пиньинь:dunmohedagan, палл.:Дуньмохэдагань    нет    Alp Qutluğ Bilgä Qağan
    Паньгуань    789 — 790    кит. упр. 泮官特勒, пиньинь:panguantelei, палл.:Паньгуаньтэлэй    кит. упр. 多邏斯,пиньинь: duoluosi,палл.: Долосы    нет    Külüg Bilgä Qağan
    Ачжо-хан    790 — 795    кит. упр. 奉诚可汗, пиньинь:fengchengkehan, палл.:Фэнчэнкэхань    кит. упр. 阿啜, пиньинь:achuo, палл.: Ачо    нет    Qutluğ— Bilgä Qağan
    Кутлуг II    795 — 805    кит. упр. 懷信可汗, пиньинь:huaixinkehan, палл.:Хуайсинькэхань    кит. упр. 骨咄禄,пиньинь: guduolu,палл.: Гудулу    кит. упр. 爱腾里逻羽录没密施合禄胡毗伽可汗, пиньинь:aitengliluoyulumeimishiheluhupigakehan, палл.:Айтэнлилоюйлумеймишихэлехупигакэхань    Ay Tängridä Ülüg Bulmıš Alp Qutluğ Uluğ Bilgä Qağan
    Кюлюг-Бильге-хан    805 — 808    кит. упр. 滕里可汗, пиньинь:tenglikehan, палл.: Тэнликэхань    кит. упр. 俱錄毗伽,пиньинь: julupiga, палл.:Цзюйлу Пига    Тэнлиехэцзюйлупигакэхань(滕裏野合俱錄毗伽可汗)    Ay Tängridä Qut Bulmıš Külüg Bilgä Qağan
    Бо-и-хан    808 — 821    кит. упр. 保義可汗, пиньинь:baoyikehan, палл.: Баоикэхань    кит. упр. 李孝誠,пиньинь: li xiao cheng,палл.: Ли Сяочен    кит. упр. 爱登里罗汩密施合毗伽可汗, пиньинь:aidengliluogumishihepigakehan, палл.:Айденлилогумишихэпигакэхань    Ay Tängri-dä Qut Bulmıš Alp Bilgä Qağan
    Чин-дэ-хан    821 — 824    кит. упр. 崇德可汗, пиньинь:chongdekehan, палл.:Чундэкэхань    неизвестно    кит. упр. 登啰羽錄沒蜜施句主毗伽崇德可汗, пиньинь:dengluoyumeimishijuzhupigachongdekehan, палл.:Дэнлоюмеймишицзючжупигачундэкэхань    Kün Tängridä Ülüg Bulmıš Alp Küčlüg Bilgä Qağan
    Чжаоли-хан    824 — 832    кит. упр. 昭禮可汗, пиньинь:zhaolikehan, палл.:Чжаоликэхань    Хэса Телей (曷薩特勒)    кит. упр. 愛登裏羅汨沒密施合毗伽昭禮可, пиньинь:aidengliluomimeimishihepigazhaolikehan, палл.:Айдэнлиломимэймишихэпига Чжаоли-кэхань    Ay Tängridä Qut Bulmıš Alp Bilgä Qağan
    Кюлюг-бег-хан    832 — 839    кит. упр. 彰信可汗, пиньинь:zhangxinkehan, палл.: Чжан Синь-кэхань    Ху Телэй (胡特勒)    кит. упр. 為愛登裏羅汨沒蜜施合句錄毗伽彰信可汗, пиньинь:aidengliluomimeimishihejulupigazhangxinkehan, палл.:Айдэнлиломимэймишихэцзюлупига Чжан Синь-кэхань    Ay Tängridä Qut Bulmıš Alp Külüg Bilgä Qağan
    Междуцарствие    839 — 840    нет    нет    нет    нет
    Хэса Тэлей (jp:コウソウ特勤)[10]                    
    Уге-хан    840 — 846    кит. упр. 乌介可汗, пиньинь:wujiekehan, палл.: Узце-кэхань    кит. упр. 乌介, пиньинь:wujie, палл.: Узце    нет    Öge
    Распавшийся каганат 847 — ок. 856 год

    В 847 году последний каган Энянь дэлэ-хан взял с собой жену, сына и 9 воинов, и уехал на запад. Больше его не видели. Знатные уйгуры, укрывавшиеся с ним у татар, стали татарскими пленниками, но вскоре 70 000 кыргызов хана Або заставили их отдать всех пленных кыргызам.
    Потеряв лидера, уйгуры «скрывались по горам и лесам» от кыргызов. Уйгурский старейшина Пан Торэ (кит. Пантэлэй — 厖特勒, zh:怀建可汗), укрывавшийся у карлуков, объявил себя каганом и княжил в городе Ганьчжоу (甘州, сейчас район Ганьчжоу (甘州区) в Чжанъе, Ганьсу). Тан Сюань-цзун отправил к нему послов. В ответ уйгуры прислали своих послов и получили от императора грамоты на имя Валу-дэнлило-мэймишихэ-цзюлу-пига-Хуай Цзюань-кэханя (嗢祿登裏邏汨沒蜜施合俱錄毗伽懷建可汗), то есть внешнеполитическое признание. Последующие десять лет он присылал подарки императору.
    В период с 860 по 873 год старейшина Пугу Цзунь (仆固俊) из Бэйтина — Бешбалыка (Недалеко от Урумчи), вёл войну с Тибетской империей — кит . Тубо Туфань, тиб. bod chen po . Он разгромил тибетского генерала, захватил Харашар и Бюгур. Его посол Дагань Михуайю (達幹米懷玉) просил у императора каганского титула для Пугу. Император согласился в 874 году, но внезапная война Пугу с Тогоном, привела к разгрому уйгур. Танская династия ослабла и перестала поддерживать своих заграничных союзников.
    Тан Чжао-цзун (888—904) посещая Фэнсянь (鳳翔 в Баоцзи) узнал от цзедуши Хань Сюня (韓遜), что уйгуры готовы помочь императору войсками. Но академик (翰林學士) Хань Во (韓偓) напомнил императору о тех ужасах, что творили вторгнувшиеся в Китай уйгуры и император не стал нанимать их.
    Связи Тан с уйгурами сократились; иногда они приезжали к границы Китая и продавали лошадей и нефрит.

    image
    Столица    745-847 Хара-Балгас
    Язык(и)    Орхоно-енисейский (рунический) язык
    Население    Уйгуры
    кидани (в Маньчжурии)
    енисейские кыргызы (берегах Енисея)
    Преемственность
    ← Восточно-тюркский каганат
    ← Басмыльский каганат
    Кыргызский каганат →
    Уйгурское Турфанское идыкутство →
    Уйгурское Ганьсуйское государство →
    Караханидское государство →
    Ляо (династия) →

    0
    • Могул
      3 ноября 2012  

      гыгы999

      Из скрытого текста видно, что в 847 году Эньэн хан с женой и 9 воинами ушел на запад и затерялся. А у Окладникова или у Гумилева, кажется, было сказано, что ушел на СЕВЕР и исчез. Так же и второй какой то Эльюй ушел со своими людьми на Север, и также бесследно исчез!? Не говорится ли здесь об этих случаях?

      0
  • offen
    3 ноября 2012  

    в свое время Г.В.Ксенофонтов пытался восстановить

    процесс включения различных субэтнических групп в состав якутского народа.
    I. первые поселенцы - улусы Сев.вилюя. (часть их урянхайцы).
    II. за ними Омолдонцы -Жарханцы и Бордонцы (и значительная часть Амгинских якутов). Северные хунны.
    III. за ними группа Таттинцев, Баягантайские, Намцы.(акающие). Эпоха жужан (протоуйгуры и остатки сев.хуннов).
    IV. за ними группа Мегино-Мальжегаров. Гаогюйцы (ранние уйгуры).
    V. за ними Кангаласцы. Поздние уйгуры. (окающие).

    с.Тиэлиги находится в Мегино-Кангаласском улусе.

    0
    • Могул
      3 ноября 2012  

      offen

      Да, уйгуров что то многовато стало!? Но, что то с именем Эньен хана по времени может сочетаться! А что все таки означает ДЬААРХАН??

      0
      • Чаархаан
        3 ноября 2012  

        Раньше уйгуры были хойхоро - хори овцеводы

        Образовались в результате тюркизации хори. У китайцев они отмечены как хойхе. Жили в Каракоруме. Курыканы откололись от них и подались на север, близ Байкала. Назвались Курыканами, потому что потеряли овцы

        0
      • Не историк
        3 ноября 2012  

        Дьаархан связан с Бордонцами .

        Оффен не может знать . Спроси самих потомков , если знают .

        0
        • Могул
          3 ноября 2012  

          Не историк

          Этимологию этого слова у нас бордонцев тоже никто не знает. Понятно, что ДЬААР связан с запахом, и с плюсом ХАН становится уже не понятным, хотя ХАН в отдельности мы тоже знаем.
          А вот Мурат Аджи кажись знает! У него ДЖАРХАН, ДЬАРХАН,... ГИРГИЙ ... означает ГЕОРГИЙ (у него переход убедительный, а книги у меня под рукой нету, потому спрашивал), то есть Святой Георгий. И он могилу Святого Георгия нашел над Дербентом в ауле под названием ДЖАРХАН!!! А у нас в Нюрбе имеются две местности под тем же названием ДЖАРХАН! И в Сунтарах, говорят, тоже есть две местности под таким же названием. Чечня - Нюрба, Сунтар - разве не удивительно? Хотя Чеченсы тоже ведь ТЮРКИ.

          0
          • Никон
            3 ноября 2012  

            Я же тебе обьяснял про Дьаархан.

            Че такой непонятливый.
            Это же каждый знает.
            Это имя одного из основных племен ураанхай саха.
            Держатели Тыгынаата Саха.
            Последние представители которых Дойдуһа-дьаархан, сын его
            Бадьаҥ-дьаархан, сын бадьаҥа-дьаархана, Мунньан-дьаархан.
            Наверное жил в гостинице Тыгын-дьаархан.
            Это протбуряты переименовали в дарга, дархан.
            По монгольски начальник.
            Монголамы командовали Дьаарханцы и оттуда остался термин
            Дьаархан = дархан. И поныне ходит.
            В начале 800хДьаарханцы и хаданцы обьединившись в союз
            Дьаархадан = Ярхадан пошли походом на китай и поработили.
            Основная масса дьаарханцев и хаданцев там растворилось
            В хара китайцах. Остатки присоединились Чингис-хану апосля.
            Ныне от дьаарханцев остались в якутии немало сел.
            ОНи до сих пор одно из основных племен саха.
            От хаданцев. Например. Сүбэтэй-бухатыыр был хадан уранхайцем.
            Советник Чингис-хана. Был его сын полководец покоривший
            во второй раз китай звали его Хадан-уранхай.
            Ныне в саха сирэ хаданцы есть. Это Анабарский улус
            Хадан-хатыгинцы живут (хатанга). Сунтарский улус два или три села хаданцы. Чурапчинский улус шесть хадан-хатылынцев. Среднеколмск хаданцы. В архиве прописаны обьединенно " Чонский бродячий род"
            Это остатки хаданцев. С реки Чуона.
            Это разве не общеизвестные вещи?
            Если хочешь узнать сах сакрал понятий дьаархан, и хадан могу изложить.
            Правда это неинтересно.
            Каждый школяр поди знает.

            0
      • Чаархаан
        3 ноября 2012  

        Меркиты - мэргэттэр (меткие стрелки)

        Мэргэн, сейчас говорят бэргэн. Кереиты - кэрэьиттэр(свидетели бога). Племя собранная единой религией, несторианцы. Среди них были сахаиты, канглы

        0
        • Оidоv
          3 ноября 2012  

          Мергэн - меткий перевод у монголов , тоже самое .

          0
          • Оidоv
            3 ноября 2012  

            Мергэн - может перевод не монгольский - знает наверное Атас .

            В истории Мергэн - меткий - одноглазый , наверное - точно не знаю . Сохор - " кривой " или что то подобие этого .

            0
        • Оidоv
          3 ноября 2012  

          Забить Болт , правильно заметил . Маалих - южное имя .

          Приемный сын Добун Мергэна - баяуд , которого взял , по его просьбе , у старика охотника баяуда . После смерти Добун Мергэна , Алан Гоу , родила ещё три сына . Их видать назвали по просьбе Бугу Хатаги , монгольскими именами . Среди них был Бодончар - предок ЧХана . Хитрый Рашид , с дальним прицелом , " дал " ему имя МААЛИХ БАЯУДай .

          0
          • Оidо
            3 ноября 2012  

            По случаю . . . , изложу версию : прямое понятие НЭРИЭТНИК , у Ураанхай саха - в позднем понимании .

            Не почитающий родителей и старших . Не помнящий заветы и предание предков . Вероятно это о нынешнем поколении . Или ошибаюсь ? Это в законе ЯССЫ , в законе ЧХана , не исполнение каралось .

            0
      • гыгы999
        3 ноября 2012  

        Наша задача найти наших предков, поэтому любая информация полезна.

        Вот от бурятов про ЧХ 2003 г.

        Скрытый текст
        Сенсационное открытие российских генетиков! Около 15 тысяч бурят являются прямыми потомками основателя Великой монгольской империи.
        Постгеномная эра, начавшаяся после расшифровки генетического кода человека, преподносит все новые и новые сюрпризы. Российские генетики получили новые данные исследований, позволяющие утверждать о наличии большого числа носителей гена Чингисхана у жителей Бурятии.


        Источник: МК Бурятии
        Автор: Александр Махачкеев

        Та самая Y¬хромосома

        Постгеномная эра, начавшаяся после расшифровки генетического кода человека, преподносит все новые и новые сюрпризы. Российские генетики получили новые данные исследований, позволяющие утверждать о наличии большого числа носителей гена Чингисхана у жителей Бурятии. Об этом сообщила “МК” Ирина Дамбуева, научный сотрудник Бурятского научного центра СО РАН, кандидат биологических наук. По ее словам, толчком к исследованиям группы российских генетиков под руководством Ильи Захарова, члена-корреспондента РАН, послужило открытие, сделанное в 2003 году английскими генетиками. Они установили тогда, что у 8 процентов жителей бывшей монгольской империи (мужского населения стран азиатского континента на территории от Тихого океана до Каспийского моря) Y-хромосома совпадает с неожиданно высокой точностью (исследования англичан не затронули народы России).

        Как показали статистические расчеты, общий предок 16 миллионов мужчин жил около восьми веков назад. Выяснить или, по крайней мере, достоверно предположить все это позволило тщательное “дактилоскопирование” мужской Y-хромосомы. Среди всех 46 хромосом в мужском наборе она - самая маленькая (по самым оптимистичным оценкам, в этой хромосоме не более 100 генов). Зато она обладает совершенно замечательным свойством: Y-хромосома переходит от отца к сыну из поколения в поколение, позволяя тем самым делать выводы о предках. Ученые, не привыкшие верить в совпадения, почти сразу назвали предполагаемое имя прародителя: Чингисхан Темучин, полководец и основатель Монгольской империи, и назвали эту гаплогруппу “кластером чингисидов”.

        Почему Чингисхан?

        Во времена его обширных завоеваний женщины были законной военной добычей и самые красивые из них доставались победителям. Как известно, у средневекового завоевателя было около ста детей, а его признанные наследники, чингисиды, были не менее любвеобильны и отличались не меньшей склонностью к продолжению рода. Как правило, все они имели гаремы с многочисленными женами и наложницами, а их потомки благодаря военной власти обладали существенным экономическим и социальным преимуществом по сравнению с населением покоренных территорий и жителями собственно Монголии. А обладание более высоким уровнем жизни и качественной наследственностью давало потомкам монгольского хана гораздо больше шансов на выживание. Это служит объяснением тому, почему первоначально небольшое потомство Сотрясателя Вселенной быстро утвердилось и разрослось за счет большего количества детей, доживших до взрослого возраста. Вот таким образом завоеватели и наложницы распространили по всей Азии ген одного-единственного мужчины. А, как отмечает известный российский антрополог, профессор Марина Бутовская, “особенности строения половой системы современных мужчин свидетельствуют, что человек эволюционировал как вид, практикующий полигинию (связи одного мужчины с несколькими женщинами)”. В некоторых традиционных восточных обществах, где принято глубокое почитание предков, до сих пор ведут родословное древо от великого завоевателя. Так, в Казахстане благодаря именно этому обстоятельству один из небольших племенных кланов обладает непропорционально большим весом в общественно-политической жизни страны.

        Российские чингисиды

        После публикации в американском журнале “Генетика человека” их российские коллеги взялись за изу-чение популяций бурят, калмыков, тувинцев, алтайских казахов и русских юга европейской части России, в частности, Белгородской области. Работа российских генетиков будет опубликована в декабре текущего года в одном из научных журналов. “Кластер чингисидов” присутствует у бурят - 2,3%; у алтайских казахов - 8,3%; у алтайцев - 3,4%; у тувинцев - 1,9 и калмыков - около 1,7%. Наиболее высокая частота кластера Чингисхана обнаружена у монголов и хазарейцев - народа, осколка монгольского мира, проживающего ныне на Среднем Востоке (Афганистане, Иране и Пакистане). “Мы продолжим исследования среди народов Поволжья - башкиров и татар, возможно, Украины - крымских татар, - говорит Ирина Дамбуева. - То есть там, где была территория Золотой Орды, основанной Бату-ханом, внуком Чингисхана. Наши исследования подтвердили исторические данные о том, что монгольское государство создавалось по типу воинского построения, по форме напоминавшее птицу с крыльями. Соответственно одним из крыльев был Алтайский хребет, горный массив, через который шло расселение монголов. Это пограничная земля, высокая частота наличия кода Чингисхана на которой объясняется, возможно, особой формой социального отбора на подконтрольной территории”. А вот среди русских “кластер чингисидов” практически отсутствует. По словам Ирины Дамбуевой, либо монголы не смешивались с местным населением, либо их власть была не настолько сильной.

        Тест Чингисхана

        Что касается бурят, то, как предполагает Дамбуева, можно провести более глубокое исследование и исследовать бурятские роды. А по предположениям некоторых бурятских историков, наибольшее число представителей золотого рода чингисидов может быть среди хатагин, сальджиут, hуhыт, когда-то пришедших из Халха-Монголии и ныне проживающих в Селенгинском, Джидинском и Закаменском районах.

        Желающие могут, наверное, сдать свой биологический материал и провести тест на принадлежность к “роду Чингисхана”. По сообщениям Интернет-СМИ, такой тест популярен на Западе. К 2006 году в картотеке Oxford Ancestors, компании, занимающейся этим, числились уже 26 тысяч желающих проверить себя. Том Робинсон, 48-летний преподаватель бухгалтерского дела из США, пробыл потомком Чингисхана меньше месяца. Несколько недель славы обеспечили Робинсону генетики: компания Oxford Ancestors взялась анализировать его ДНК еще в 2003 году. А в мае нынешнего пришла к заключению, что монгольский хан был прямым предком эксперта-бухгалтера по мужской линии. Пока о Робинсоне писала New York Times и готовились снимать фильм кинематографисты, другие исследователи перепроверяли его геном. И объявили несколько дней назад, что вакансия “живого западного чингисида” снова открыта. Узнать о своей принадлежности к роду Чингисхана могут и женщины - для этого достаточно проанализировать генетический материал отца или брата...

        Чингисхан (1155-1227 гг.) - человек, изменивший ход истории и сознание человечества на протяжении последнего тысячелетия. Повелитель монголов создал величайшую в истории империю, подчинившую в XIII веке огромные пространства Евразии от Японского моря до Черного. Им и его потомками сметены с лица земли великие и древние государства: государство Хорезмшахов, Китайская империя, Багдадский халифат, покорена большая часть русских княжеств. Громадные территории были поставлены под управление степного закона, носившего название “Яса”.

        Но, в отличие от других завоевателей, на протяжении сотен лет до монголов, господствовавших над Евразией, только Чингисхан сумел организовать стабильную государственную систему и сделать так, что Азия выступила перед Европой не просто неизведанным степным и горным пространством, но консолидированной цивилизацией. Именно в ее границах потом началось тюркское возрождение исламского мира, своим вторым натиском (после арабов) чуть было не добившего Европу.

        В государстве монголов был установлен принцип веротерпимости. Путешественники описывали, что перед шатром великого хана стояли церковь, мечеть, буддийская пагода и приплясывали шаманы.

        Но самое главное, что Чингисхан явился своего рода апокалиптическим напоминанием европейскому христианскому и азиатскому исламскому мирам. Вслед за десятилетиями междоусобиц, в которых единоверцы истребляли друг друга ради куска земли или россыпи золотых монет, приходит “бич Божий” и отбирает у всех подряд и землю, и золото, и саму жизнь.

        Монголы и вообще народы Азии почитают Чингисхана как величайшего героя и реформатора, почти как воплощение божества. В европейской (в том числе и русской) памяти он остался чем-то вроде предгрозового багрового облака, которое появляется перед страшной всеочищающей бурей.

        Вот нашел исследование генетиков калмыков 2003 кажись года-переводил с английского онлайн.
        Скрытый текст
        Генетические доказательства для монгольского происхождения калмыки Иван Насидзе, 1 * Доминик Quinque, 1 Изабель Dupanloup, 2 Ричард Cordaux, 1 Людмила Kokshunova, Марк Стонекинг 1 1 Департамента эволюционной генетики, Институт Макса Планка эволюционной антропологии, D-04103 Лейпциг, Германия 2 центра интегративной геномики, университета Лозанны, CH-1015 Департамента Dorigny Лозанне, 3 человека и животных физиологии, Калмыцкий государственный университет и 3Г. Элиста 358000, Республика Калмыкия, калмыки ключевые слова Российской Федерации; Хромосома y; мтДНК АБСТРАКТНЫЙ калмыки являются этническая группа вдоль нижней Волги в России, кто думал там мигрировали из Монголии около 300 лет назад.
        Расследовать их происхождение, мы изучили мтДНК и y-хромосомы различия в 99 Калмыков. Последовательностей мтДНК HV1 и гаплогруппы y-хромосомы SNP свидетельствуют о тесной связи Калмыков с монголов. Кроме того генетического разнообразия для мтДНК и Y-хромосомы сопоставимы в калмыки, монголы и другие Центральной Азии группы, указав, что калмыцкого миграции не был связан с узким существенной. Так называемые '' Чингисхана '' y-хромосомы короткие тандемные повторные гаплотип (STR) был обнаружен в высоких частот (31,3%) среди калмыков, дальнейшей поддержки сильной генетическая связь между калмыками и монголов. Генетический анализ даже последние, относительно хорошо документированных миграций такие как Калмыков может таким образом привести к новые идеи, касающиеся таких миграций. Am J РЬуз Anthropol 126:000–000, 2005. ' 2005 Уили Лисс, Inc.
        Генетические доказательства для монгольского происхождения калмыки Иван Насидзе, 1 * Доминик Quinque, 1 Изабель Dupanloup, Калмыков (также известный как Khalmag) в настоящее время живут вдоль Западного берега реки Нижняя Волга но подуманы быть потомками Oyrats, происходящих из западной Монголии (Джунгария). В конце XVI-начале XVII веков deficit пастбищных земель и феодальной междоусобных раскол привело большие Ойрат союзы племен Torgouts и Derbets для переноса в степи Западной Сибири (Erdeniev, 1985). После Ермака экспедиция (1579–1584) эти территории пришли под контролем России, и в 1608 и 1609 Oyrats дал клятву верности русского царя. Их потомки поселились на территории ограничивается Урал и Волгу (рис. 1). Во второй половине XVII века они сформировали калмыцкого ханства в нижней Волги и заложил основу для новой монгольский говорящих этнической группы, Калмыков (Erdeniev, 1985). Нет никаких доказательств от исторический рекорд для любых последующих миграции из Монголии в этом регионе; Таким образом Калмыков были выделены некоторые 300 лет от их предполагаемых родителей населения.
        Относительно Калмыков, имеется мало населения генетической информации. Анализ классических генетических маркеров (кровь группы або и RH(D), сыворотка протеинов HP, TF и GC и красных клеток ферментов ACP1, PGM1, ОУР, GLO1 и дерново-A) предложил генетическое сходство калмыки, с современным буряты Байкальского региона Юго-Восточной Сибири и монголов (Галушкин et al., 2002). Полиморфизмы глутатион S-трансферазы M1 и T1 (GSTM1 и GSTT1) также предложить сходство между калмыками и буряты (Попова et al., 2002).
        Для того, чтобы проверить, является ли предполагаемый истории недавно монгольского происхождения Калмыков reflected в их мтДНК и y-хромосомы гена бассейны, а также оценить ли узкое место было связано с калмыцкого миграции и степень возможных последующих материнской или отцовской линии примесь между калмыками и окружающего населения, мы проанализировали митохондриальной ДНК HV1 текущий адрес Ричард Cordaux: Биологического вычислений и визуализации центр, Отделение биологических наук, Университет штата Луизиана, 202 жизни наук здание, Батон Руж, LA 70803.
        Переписка с: Иван Насидзе, Департамент эволюционной генетики, Макс Планк Институт эволюционной антропологии, Deutscher Platz 6, 04103 Лейпциг, Германия.
        E-mail: nasidze@eva.mpg.de Грант спонсор: Общество Макса Планка, Германия; Грант спонсор: Итальянский национальный исследовательский совет; Грант спонсор: Европейский научный фонд; Номер гранта: JA03-В02.
        Получил 23 февраля 2004 года; принято 3 августа 2004 года.
        ДОЙ 10.1002/ajpa.20159 Опубликовано онлайн Wiley InterScience (www.interscience wiley.com).
        последовательность изменчивости, проверку 9-ВР удаления между АНИОНА генов и митохондриальных tRNAlys, и генотипным 13 biallelic маркеров и девять короткие тандемные повторить (STR) локусов в Y хромосоме в 99 Калмыков. Мы сравнили модели мтДНК и y-хромосомы различия в Калмыков с данными от их географических соседей и их предполагаемого источника населения.
        МАТЕРИАЛЫ и методы образцов ДНК и добыча в общей сложности 99 щеку клеток образцов из несвязанных мужского лица были собраны в Элисте (Республика Калмыкия, Российская Федерация). Информированного согласия и информацию о рождения, родители и бабушки и дедушки были получены от всех доноров.
        Геномной ДНК от щеку клеток тампоны был извлечен с помощью процедуры засолки out (Miller et al., 1988)
        \Митохондриальная ДНК сегмента гипервариабельных первым области управления некодирующей мтДНК (HVI) был amplified с праймерами, L15996 и H16410 (Vigilant et al., 1989), как описано выше (свод et al., 1995). Вложенные праймеры L16001 (Cordaux et al., 2003) и H16401 (Vigilant et al., 1989) были затем используется для определения последовательности для обеих нитей продуктов ПЦР с ДНК последовательности Kit (Перкинэлмер), после протокол, рекомендуемый поставщиком и с ABI 3700 автоматизированного ДНК секвенсор. Последовательности с C в позиции 16189 (Anderson et al., 1981) обычно прекращается преждевременно в регионе '' C-стретч '' (позиции 16184– 16193); Эти были снова секвенирован в каждом направлении, таким образом, чтобы каждая база был определен дважды.
        Опубликованные мтДНК HV1 последовательности использовались также от 139 Саха и 56 эвенов (Pakendorf et al., 2003), 46 Itel'men (Шерр et al., 1999), 36 тувинцев и 76 буряты (Derenko et al., 2002), 58 эвенков (Торрони et al., 1993), 84 Сиань и 82 Чанша китайцев хань (Оота et al., 2002), 89 японский (Хорай et al., 1996), 102 русские (орехов et al., 1999)18 Славян (Maliarchuk et al., 1995), 55 казахов и 94 Кыргызской (Комас et al., 1998), 103 монголов (халха-монголы и Daridanga) (Kolman et al., 1996), 17 алтайцев (щитов et al., 1993) и 13 Мари (Sajantila et al., 1995).
        9-ВР удаления в intergenic регионе АНИОНА тРНК lys был показан во всех пробах, как описано в других местах (свод et al., 1995). Для сравнительного анализа были использованы опубликованные данные для этого маркера из Сибири, Центральной Азии и Восточной Азии (Sambungyin et al., 1991; Харихара et al., 1992;
        Petrischev et al., 1993).
        Двенадцать предполагается SNP маркеров y-хромосомы (М130 (RPS4Y), М48, М9, M46 (ТАТ C), M89, M124, M45, M173, M17, M201, M170 и M172) (Андерхилл et al., 2000; Zerjal et al., 1997) и полиморфизм YAP алюминиевые вставки были типизированные (молоток и Хорай, 1995). Маркеры М9, M46 и RPS4Y были введены с помощью ПЦР-ПДРФ анализы, как описано в других документах (Kayser et al., 2000; Zerjal et al., 1997). Маркеры M17, M124, M170, M172 и M201 были введены с помощью грунт введены ограничения анализа (Пира)-анализы ПЦР (Ёсимото et al., 1993), как описано ранее (Cordaux et al., 2004). M89 введенного assay PIRAPCR, как описано ранее (Kayser et al., 2000a). Новые анализы Пира-PCR были разработаны для M173, M48 и M45 (таблица 1). YAP алюминиевые вставки был введен как описано выше (молот et al., 1995). Образцы были генотипным по словам иерархический порядок маркеров (Андерхилл et al., 2000). Номенклатура гаплогруппы Y-SNP, используемые здесь согласно рекомендациям консорциума Y-хромосомы (2002).
        ОНП M45, M48 и M173 Y хромосома SNP 1
        маркер/ грунты /энзимами ограничения /размеров переваривается продуктов ПЦР, которую
        M45 для AATTGGCAGTGAAAAATTATAGCTA NlaIV 128 bp þ 23 bp Rev-AACTCTCCTACTCTGATGAGCA M48 для AATTGGCAGTGAAAAATTATAGCTA BstF5I 60 bp þ 30 bp Rev-TCAATGTAAATGTTAGTATAAGGATG M173 для TTACAATTCAAGGGCATTTAGGA NlaIV 129 bp þ 23 bp Rev-AGGTGTATCTGGCATCCGTTA 1 производные состояние каждого SNP усваивается рестрикции. M
        От 42 тувинцев, 24 монголы, 45 корейцев, 44 каракалпакском, 56 Узбекистана (Бухара), 68 Узбекистана (Сурхандарьинская), 70 Узбекистана (Хорезм), 43 Узбекистана (Ташкент), 63 Узбекистана (Ферганская долина), 45 Узбекистана (Самарканд), 25 Ишкашимский, 30 Бартангский использовались опубликованные данные Y-SNP Восточной Европы и Центральной и Восточной Азии 44 Shugrian, 31 ягнобского, 22 Таджикистана (Koiant), 16 Таджикистана (Dushambe), 52 Кыргызской, 40 дунганский, 54 Казахский41 Уйгурского, 28 Поморская, 49 русские (север), 89 русские (Ташкент) и 38 Казань татарское (скважины et al., 2001).
        Были проанализированы девять y-хромосомы короткие тандемные повторить (Y-STR) локусов: DYS19 (ассоциируется с DYS394, amplified с различных грунт, определите, как описано в других местах) (Kayser et al., 2001), DYS385a, DYS385b, DYS389I, DYS389II, DYS390, DYS391, DYS392 и DYS393. Эти места были amplified в pentaplex и четырехместных PCRs, или же в одном nanoplex PCR и проанализированы на Аби Призма 377 ДНК секвенсор (применяется биосистем), как описано в других местах (Kayser et al., 1997). Для того, чтобы отличить генотипов на повторяющиеся DYS385a и DYS385b локусов, дополнительные ПЦР осуществляется вне (Киттлер et al., 2003) и проанализированы на Аби Призма 377 ДНК секвенсор (применяется биосистем).
        Основные параметры статистический анализ молекулярных разнообразия и генетические структуры населения, включая анализ молекулярных дисперсии (AMOVA) и Минимальное остовное сеть для Y-STR гаплотипов, были рассчитаны с использованием программного пакета Arlequin 2.000 (Шнайдер et al., 2000). Fst значения были рассчитаны на количество попарных различий между HV1 последовательностей или Y-SNP гаплотипов; Статистическая significance бригаде ценностей оценивалась по перестановка анализа, с помощью 10 000 комбинаций. Статистическая significance корреляции между Генетическое расстояние матриц на основе мтДНК HV1 последовательностей и y-хромосомы SNPhaplogroups оценивалась Mantel тест с 10000 перестановок. Пакет STATISTICA (StatSoft, Inc.) был использован для многомерного анализа масштабирования (MDS). Анализ сети для мтДНК HVI последовательность данных осуществлялась с использованием программного пакета сетевой версии 3.1 (Bandelt et al., 1999) и сосед присоединение дерево HV1 последовательностей был построен с использованием PYLIP (Felsenstein, 1993).
        РЕЗУЛЬТАТЫ мтДНК различия в целом, 377 bp региона мтДНК HV1, включающий нуклеотидной позиции 16024–16400 (Anderson et al., 1981), были определены для 99 Калмыков.
        Для целей сравнения последовательностей, сообщили здесь с опубликованными данными, дополнительные анализы были ограничены 365 bp (нуклеотидной позиции 16024–16388) из HV1. Как проверки на точность HV1 последовательностей мы использовали метод сети для поиска так называемые '' Фантом '' мутации (Bandelt et al., 2002). Такие артефакты были найдены в Калмыцкий HVI последовательности (анализ не показан).
        Последовательности будут зачислены в базе HVRbase (www.HVRbase.de) в момент публикации.
        В таблице 2 представлены параметры, резюмируя некоторые характеристики мтДНК HV1 последовательности изменчивость в калмыки и дополнительного населения Центральной и Восточной Азии и Восточной Европы.
        Гаплотип разнообразия был 0.996, среди высоких значениями, наблюдаемыми в группах из этого региона (таблица 2). Среднее количество нуклеотидов попарных различий (MPD) был 6,80, который превышает верхний предел диапазона MPD значения в европейских групп (3.15–5.03) (Комас et al., 1997), но сопоставимо с значения MPD для Центральной Азии группы (5.91–6.64) (Комас et al., 1998).
        Попарных Fst указывают что наименьшие значения находятся между калмыками и монголов (Fst ¼ 0,007, P ¼ 0,029) и затем между этими двумя группами и Центральной и Восточной Азии. MDS сюжет (рис. 2A) на основе индивидуальных попарных Fst значения дальнейшего confirms эти замечания: Калмыков кластер с монголы, Казахстана, Кыргызской, буряты и некоторых других, Центральной и Восточной Азии населения. Восточной Европы группы кластера отдельно от Калмыков.
        Хотя эти анализы показывают, что HV1 калмыцкого последовательности как целая группа с монгольской последовательностями, может быть, что некоторые отдельные последовательности калмыцкого HV1 являются Восточной Европы (или других) происхождения. Поэтому мы построили соседа присоединение дерево (основанный на p расстояния, т.е. количество попарных различий) 304 отдельных мтДНК HVI последовательностей от русских, калмыки и монголов.
        Большинство калмыцкого HV1 последовательностей (более чем 80%) кластерного с монгольской последовательностей, тогда как российский последовательности сформировали отдельные ветви на дереве, с лишь немногие из калмыцкого последовательностей, сгруппированы с русской последовательностей (дерево не показан).
        HV1 последовательности изменчивость в Kalmykians 1
        населения N No. гаплотипов гаплотип разнообразия SE MPD Тадзима D источник Kalmykians 99 85 0.996 0,002 6,80 1,83 настоящем исследовании
        тувинцев 36 28 0.978 0,015 6.89 1,14 Derenko et al., 2002
        Саха 139 44 0.961 0,007 6,47 1,20 Pakendorf et al., 2003
        Ительмен 46 18 0,929 0,022 4.14 0.57 Шерр et al., 1999
        Эвен 56 25 0.949 0,016 5,59 0,95 Pakendorf и др.2003
        Эвенков 58 23 0.936 0,017 6.09 0,98 Торрони et al., 1993
        Сиань (ханьских) 84 76 0.997 0,002 5,82 1,77 Оота et al., 2002
        Чанша (ханьских) 82 70 0.995 0.003 6.22 1.87 Оота et al., 2002
        японский 89 62 0.982 0.006 5.01 1,99 Хорай et al., 1996 буряты 76 58 0.992 0,004 7.14 1,83 Derenko et al., 2002
        русские 102 63 0.964 0,012 4.22 1.99 орехов и др.1999
        Славян 18 18 1.000 0,019 4.41 1.35 Maliarchuk et al., 1995
        Казахский 55 45 0.990 0.006 6.64 1.81 Комас et al., 1998
        Киргизский 94 69 0,989 0,004 6.25 1,95 Комас et al., 1998
        монголы 103 82 0.995 0,002 6.51 1.82 Kolman et al., 1996
        Мари 13 10 0.949 0,051 4.13 1.22 Sajantila et al., 1995
        алтайцев 17 16 0.993 0,023 5,52 1,25 Шилдс и др.1993
        1
        Из некоторых групп населения Сибири и Центральной и Восточной Азии данные для сравнения. N, размер выборки; MPD, среднее количество в попарных различий.
        4 Я
        Частота удаления intergenic 9-ВР АНИОНА тРНК lys был около 7% в Калмыков, похож на частоты, корейцы, монголы и буряты (таблица 3). Поскольку удаление 9-bp является практически отсутствует в Восточной Европе (таблица 3), эти результаты дальнейшей поддержки в Центрально-Восточной Азии происхождения Калмыков.
        Гаплогруппы Y-SNP 9 Y-SNP гаплогруппы были найдены в Калмыков (таблица 4). Были наиболее часто гаплогруппы C * (RPS4Y) и C3c (M48), а затем значком K ♦ (M9) и P (M45); вместе частота этих гаплогрупп была 0,858. Гаплогруппа C * является распространенным явлением в Центральной Азии и на монгольский населения, но отсутствует в Восточной Европе (таблица 4). Гаплогруппа C3c происходит на ощутимый частотах только в монголы и казахи, то время как гаплогруппы, которую K является широко распространяется практически во всех Восточной Европы и Центральной и Восточной Азии групп (таблица 4). Гаплогруппа P * отсутствует или присутствует в очень низких частот в почти всех Восточной Европы и Центральной и Восточной Азии групп. Общие гаплогруппы y-хромосомы N3 * в Восточной Европы группы был найден только в Калмыцкий некто из 99 (таблица 4). Другие Kamlykian Y-гаплогруппы произошло на низких частотах (менее 10%). Гаплогруппа разнообразие в Калмыков (0,773) как высока, как и в Центральной Азии населения (в среднем 0.762) и выше, чем в Восточной Европы групп (Средняя 0,755).
        Попарных сравнений ОНТ показал тесные отношения Калмыков с монголов (Fst ¼ 0,010, P ¼ 0.221); в отличие от Восточной Европы и Центральной Азии группы были более отдаленные от Калмыков (средняя Fst ¼ 0.224 и 0.164, соответственно). MDS участок (рис. 2B) аналогичным образом групп калмыков с монголов, с казахи как следующая группа наиболее близок.
        Y-SNP М-201, который отличает гаплогруппы G * от гаплогруппы ВН, не анализировалось скважинами at al. (2001) в популяциях, используемое для сравнения. В наш анализ эти люди были рубричной как Гаплогруппа ВН, хотя некоторые неизвестные пропорции в действительности может быть гаплогруппы G *. Чтобы определить, если эта неспособность различать гаплогруппы F и G * для некоторых групп influences результаты анализов MDS и ФСТ, мы рубричной всех гаплогруппы G * Калмыцкий лиц как Гаплогруппа ВН и повторить анализы. (Не показано) результаты были практически идентичными; Таким образом неспособность провести различие между гаплогруппы F и G * в некоторых группах не не influence наши выводы.
        Образец монголы, на которых мы строим наш вывод о тесной взаимосвязи генетических калмыками и монголы довольно мал, с только 24 человек (скважины et al., 2001). Данные о гаплогруппы Y-SNP доступны для более широкой выборки монголов (147 человек) в Karafet et al. (2001). Однако, это исследование не проводится различие между гаплогруппы C * (RPS4Y) и C3c (M48), которые имеют частоты 0,24 и 0,37, соответственно, в калмыки. Поскольку неспособность различать эти гаплогруппы может привести к неточным выводам, в выше анализа мы использовали меньший монгольский набор данных из скважин et al. (2001), в котором выделялись гаплогруппы C и C3c. Тем не менее исследовать influence размер выборки на наши выводы, мы включили данные из Karafet et al. (2001), объединив гаплогруппы C и C3c; результате MDS участок (не показано) группы монголов от обоих исследований с калмыками.
        Y-STR гаплотипов двух мужчин конкретных аллелей были замечены на DYS19 в 31 Калмыков, указывающий региональный y-хромосомы дублирование с последующим микроспутника мутации. 14 Гаплотипов были замечены (таблица 5), все на фоне гаплогруппы C3c. дублирование DYS19 ранее наблюдалось в монгольском, казахской и Кыргызской Y хромосомы, хотя и низкой частотой, в Кыргызстан и на более высоких частотах в монголы и казахи (C. TylerSmith, личное сообщение). Кроме того дублирования в казахи главным образом предполагает аллелей 15 и 17, тогда как монголы и Kalymks основном экспонат аллелей 16 и 17 (C. Тайлер-Смит, личное сообщение), дальнейшее укрепление связи между монгольской и Калмыцкий Y хромосомы.
        Y-STR гаплотипов в гаплогруппы C3c фон проявляют '' звезда как '' конфигурация в Калмыков (рис. 3), как отмечалось ранее, для Y-STR гаплотипов в гаплогруппы C3c фон в Монголии (Zerjal et al., 2003). Мы оценили время для самого последнего общего предка (TMRCA) для калмыцкого Y-STR гаплотипов в гаплогруппы C3c фон, используя оценку r (Morral et al., 1994). Предположив время генерации 30 лет, TMRCA оценка-855 лет (95% границам интервала в кон fidence, 560–1, 160 лет), который является замечательным соглашения с оценкой TMRCA 860 лет эта гаплогруппа монголов (Zerjal et al., 2003).
        Сравнение мтДНК и y-хромосомы данных относительно многообразия в рамках населения, Калмыков экспонат уровни разнообразия гаплотип гаплогруппы и мтДНК Y-SNP, которые сопоставимы с Востока и Центральной Азии и Восточной Европы группы (таблицы 2 и 5). Попарных Fst основе гаплогруппы Y-SNP значение Низкая между Kalymks и монголов (Fst ¼ 0,010), а затем Центральной Азии группы (средняя Fst ¼ 0.164) и затем Восточной Европы группы (средняя Fst ¼ 0.224). Аналогичным образом, основываясь на последовательностей мтДНК HV1, наименьшее значение Fst является между калмыками и монголы (Fst ¼ 0,007), а затем снова Центральной Азии группы (средняя Fst ¼ 0,05) и затем Восточной Азии группами (средняя Fst ¼ 0,058). Однако, корреляция между попарных расстояний Fst среди пар калмыками и Восточной Европы и Центральной Азии групп на основе мтДНК и Y хромосомы, не статистически значительное (каминные тест, Z ¼ 0,168, P ¼ 0.334), предлагая некоторые различия в генетической структуре этих групп на основе мтДНК против Y-хромосомы.
        Географические и языковые структуры Kalmykian, Восточной Европы и Центральной Азии групп, оценены мтДНК и y-хромосомы вариации, дальнейшее расследование в порядке, AMOVA. Для мтДНК географических и языковых групп дали аналогичные результаты (таблица 6).
        Это вероятно потому, что двумя основными группировками являются очень похожи, отличаясь только что географически калмыки группы с казахами, кроме алтайцев, Кыргызской и монголов, тогда как лингвистически калмыки группы с монголов, и казахи группы алтайцев и киргизов (таблица 6). Однако для гаплогруппы Y-SNP, уровень betweenpopulation дифференциация был намного выше, чем для мтДНК; Кроме того классификация групп на основе географии дал гораздо лучше подходят данных, чем лингвистических classification в том, что среди группы компонент был намного больше, чем среди населения в рамках группы компонент для географической classification (таблица 6).
        ОБСУЖДЕНИЕ, мтДНК и y-хромосомы результаты указывают на то, что калмыки наиболее тесно связаны с Монголы. Это полностью соответствует их истории, который указывает, что в начале XVII века, большие группы Ойрат племен Западной Монголии переехал в их текущий дом в Поволжье (Erdeniev, 1985). Derbets были вторым по величине племенные подразделения Oyrats, а затем Khoshuts. Были также меньшие племенных групп, таких как Zungars, Khoits и тсаатаны. Они мигрировали на левом берегу реки нижней Волги и находятся сейчас в городах России от Астрахани в Самаре.
        Генетические результаты не просто confirm исторические записи, но также добавлять дополнительные идеи в Калмыцкий миграции. Уровни генетического разнообразия для мтДНК и Y хромосомы, сопоставимы с калмыками и монголов, указав, что не было никаких потерь разнообразия, и следовательно нет узких мест, связанных с этой миграции. Даже разнообразие Y-STR, связанный с C3c гаплогруппы в калмыки является практически идентичен сообщалось ранее в Монголии (Zerjal et al., 2003). Таким образом, число обоих мужчин и указывают, что калмыки наиболее тесно связаны с женщин, участвующих в миграции Калмыков должны были существенными. Это в отличие от других человеческих миграции, для которых узкие места постулировали для мтДНК или Y-хромосомы (или оба), такие как колонизация Полинезии (Kayser et al., 2000a), миграция тюркоязычных якутов в Сибирь (Pakendorf et al., 2002) и поселение нового света (Торрони et al., 1993 год; Starikovskaya et al., 1998;
        Bortolini et al., 2003). Сравнивая калмыцкого миграции с таких миграций поэтому может пролить свет на социальные или другие обстоятельства, что influence количество мигрирующих лиц.
        Генетические результаты свидетельствуют также о что было не значительные примеси с русскими, по материнской или отцовской линии, во время 300 лет, которые Калмыков проживают в непосредственной близости от русских. Отсутствие обнаружению сходство между русскими и калмыки делает не просто reflect insufficient время для таких примесь произошли, поскольку европейские примеси могут быть легко обнаружены в афро-американцев (Kayser et al., 2003), чье время глубина в Северной Америке он сопоставим с калмыками в России. Другие миграций, такие, как те, Полинезия (Kayser et al., 2000a), сопровождались значительные примеси, получается что существуют конкретные социальные обстоятельства, которые либо способствовать, либо препятствовать примесь. Калмыков отличаются от русских в язык, религия и суточных, однако не ясно, если эти факторы только sufficient для ингибирования примеси, как есть свидетельства для российских примесь с якутами (Pakendorf et al., 2002), которые также отличаются, язык, религия и суточных. Может быть, что существенный размер калмыцкого миграции (о чем свидетельствует отсутствие уменьшение разнообразия мтДНК или Y-хромосомы) препятствует примесь, но дальнейшее сравнение калмыцкого миграции с других миграций необходимо понять факторы, что influence примесь.
        МтДНК и y-хромосомы результаты также согласуются в указанием некоторую степень генетического сходства между казахами и калмыки. Этот контраст между казахским и русским примесь с калмыками приводит к предсказание, что калмыцкого языка может показать большее влияние (то есть, заимствование) от казахского чем с русского, или что на казахском языке может показать influence Калмыцкий язык. Действительно несмотря на тот факт, что казахи говорят на тюркском языке, есть много монгольских слов кредита на казахском языке (л. Йохансон, личное сообщение), хотя необходима дальнейшая работа для демонстрации specifi - частности Калмыцкий происхождение этих слов.
        Необычная генетическая особенность Калмыков является высокая частота повторяющихся аллелей для DYS19 Локус. В то время как повторяющиеся аллелей в DYS19 были обнаружены в Монголии (C. Тайлер-Смит, личного общения), они с частотой гораздо ниже (10,8%), чем в Калмыков (31,3%). В других популяциях дублирование DYS19 является крайне редко, происходящих на общей частоте 0,12%, основанные на 7,772 лиц (соавт. Кайзер, 2000b).
        Это необычное дублирование далее указывает на тесную связь Калмыков с монголы.
        ВЫВОДЫ генетических результаты поддерживают исторический рекорд в том, что они свидетельствуют о тесной взаимосвязи между калмыками и монголов. Кроме того генетические результаты показывают, что калмыцкого миграции участвует значительное число людей, и что Калмыков не испытали обнаружить примесь с русскими. Таким образом генетические исследования даже такие недавние, относительно хорошо документированных миграции как Калмыков может предоставить дополнительные взглянуть на обстоятельства таких миграций. Кроме того контрастные калмыцкого миграции с других миграций, которые отличаются в одной или нескольких аспектах (например колонизации Полинезии или новый мир, оба из которых вовлечены значительные узких мест) могут пролить свет на последствия человеческой миграций.
        БЛАГОДАРНОСТИ мы благодарим Манфред Кайзер и Брижит Pakendorf за полезные дискуссии. Это исследование было поддержано Общество Макса Планка, Германия. И.д. была поддержана грантов от итальянской национальной исследовательский совет (КНП), в рамках Европейского научного фонда евро ядер программа '' происхождение человека, языка и языков '' (проект JA03-B02).

        А вот интересная статья казаха Сабитова Жаксылыка про потомков ЧХ.
        И немножко с русских сайтов.
        Скрытый текст
        В поисках Чингиз-хана.


        Сабитов Жаксылык

        babasan@yandex.ru


        Опять будут охотно искать
        Чингис-хана и не найдут.
        (фрагмент из Ясы Чингиз-хана)


        На написание этой статьи меня подвиг информационный вакуум, существующий в отношении чингизидов. Конечно, в отдельных народах существуют свои исследования о местных чингизидах, но нет ни одной статьи, посвященной чингизидам в общем. Это, прежде всего, связано с тем, что чингизиды присутствовали в различных народах от монголов и бурятов на востоке до поляков и румын на западе, от русских и татар на севере до индусов и пакистанцев на юге.

        Сама же задумка написать такую статью появилась с сообщения о 16 миллионах современных потомков Чингиз-хана в статье «The Genetic Legacy of the Mongols» (2003). Рассмотрим эту статью критически.

        Основными тезисами статьи были:

        1. Протестировано 2123 человека по 32 маркерам в Азии.

        2. В 16 популяциях в Азии от Тихого Океана до Каспийского моря встречается очень распространенный гаплотип, который они назвали «Звездный кластер» («старкластер»).

        3. Авторы посчитали, что процент обладателей гаплотипов, относящихся к данному старкластеру, должен составить 8 % в Азии и 0,5 % по всему миру.

        4. Расчет времени жизни предка для обладателей гаплотипов старкластера дал 1000 лет назад (с учетом вариаций они оценили срок жизни предка как 700-1300 лет назад с надежностью 95%)

        5. Они оценили скорость распространения старкластера и пришли к выводам, что оно превышает все нормы и не является случайным дрейфом

        6. Экстраполируя результаты их расчетов на все население Азии, они пришли к выводу, что гаплотипы старкластера имеют 16 миллионов человек.

        7. Предковый гаплотип старкластера в формате FTDNA выглядит так:

        13-25-X-10-X-X-11-14-10-10-11-16

        8. Гаплогруппа предка старкластера – С(хС3с), то есть гаплогруппа С, в которую не входит подгруппа С3с.

        После оглашения тезисов мы хотели бы перейти к критике:

        1. Возражения методологического плана: методологически авторы определили гаплотип «Чингиз-хана» в отрыве от истории и классической генеалогии, исходя из посылки, что большая группа людей в Монголии имеет общего предка, жившего в эпоху Чингиз-хана (или немного до него). Следовательно, они, скорее всего, потомки человека, который имел высокое социальное положение, следствием чего стало большое количество жен и большое количество потомков. Идеальным кандидатом на эту роль был Чингиз-хан. К тому же пиар, реклама, научные гранты и деньги от спонсоров очень нужны были для новой науки.

        Но по прошествию нескольких лет мы должны попытаться по настоящему разобраться в вопросе, используя данные классической генеалогии и истории.

        В первую очередь мы хотели бы отметить, что высокий социальный статус человека в прошлом не гарантирует, что у него будет огромное количество потомков. Скорее наоборот, мы хотели бы сказать, что высокий социальный статус человека всегда говорит о том, что у него будет относительно малое количество потомков. Например, во времена образования казахского хана жили два чингизида Джанибек и Гирей (троюродные братья), кроме них жил аргынский бий Акжол. В итоге чингизидов, потомков Джанибека, у казахов несколько тысяч, Гирей не оставил потомков, а у Акжола около одного миллиона потомков. Также говоря о чингизидах надо отметить, что демографический взрыв среди них пришелся на 18-й век (до демографического взрыва были известны около 10-20 чингизидов, потомков Джанибека) и продолжился в 19-м веке, когда чингизиды утратили свой высокий социальный статус в Казахстане после реформ второй половины 19-го века. С 15-й по 17-й века количество казахских чингизидов ориентировочно не превышало 500 человек. При хане Ишиме было около 120 чингизидов. То же самое можно сказать про Монголию, где в 15-16 веках на всю Монголию был один чингизид, Даян-хан.

        Этим мы хотим сказать, что утверждение о том, что высокий социальный статус является причиной большого количества потомков изначально не верно, так как по теории Голдстоуна-Нефедова и предположениям Крадина количество элиты всегда ограничено и ее перепроизводство всегда идет к войнам, где излишняя элита уничтожается путем физического устранения. Динамика количества членов правящей элиты обычно имеет цикличный характер. Сначала происходит бурный рост количества представителей правящей династии, потом из-за перепроизводства элиты начинаются гражданские войны, которые приводят к тому, что либо уничтожается большая часть представителей правящей династии, либо государство распадается [1].

        Таким образом, мы хотим сказать, что признание большого количества населения Монголии потомками Чингиз-хана изначально неверно исходя из самой методологии, а также из-за отсутствия тестов реальных потомков Чингиз-хана среди монголов.

        Кроме того, если взять пример с китайскими казахами, то около 20 % их являются представителями «старкластера». Мы точно знаем, что там живут представители двух казахских родов Найман и Кирей. Причем в каждом племени есть по две генеалогические мужские линии. Самих же потомков Чингиз-хана (казахи рода торе) в Китае проживают не больше нескольких тысяч. Общее число казахов в Китае примерно 1,5 миллиона человек. Судя по генеалогии ДНК, чингизидов среди казахов в Китае будет меньше 1 %, что противоречит подсчетам из статьи.

        В казахском ДНК-проекте (www.elim.kz) единственным обладателем старкластера является представитель рода Керей (ашамайлы), а генеалогические потомки Чингиз-хана имеют немного отличающийся гаплотип, который мы рассмотрим ниже.

        Также хотелось бы заметить, что полигамия не была сугубо привилегией ханов и чингизидов. Любой обеспеченный человек мог себе позволить гарем. Так что тут действует принцип «Если б я был богат, я имел сто жен». Полигамией можно объяснить взрывное распространение старкластера сначала в самой Монголии, а потом при миграциях 13-го века по всей Азии.

        Еще одним аргументом в пользу написания статьи является то, что с помощью новых методов мы, возможно, сможем решить восьмивековую задачу об отцовстве Джучи, путем сравнения гаплотипов Джучи и Даян-хана, потомков братьев Чингиз-хана.

        Забегая вперед, мы скажем, что в этой статье мы не решим задачу выявления гаплотипа Чингиз-хана, мы просто сделаем первый шаг. Для этого мы очертим круг чингизидов из разных народов, и тем самым покажем общий план мозаики, которую хотим собрать. Сами же мы заполнили мозаику пока только процентов на пять. Фактически мы занимаемся наложением данных ДНК-генеалогии на генеалогическую карту чингизидов, а так как нам пока известны только гаплотипы казахских чингизидов, то получается, что мы закрыли только малую часть мозаики.

        Хотелось бы также четко внести дефиниции в нашей статье. Если мы говорим о гаплотипе какого-нибудь чингизида, мы пишем либо о реальном человеке, который стоит в стороне от других веток чингизидов, либо мы пишем об общем первом предке для нескольких чингизидов. Например, если мы пишем о гаплотипе Джанибек-хана (родился не позднее 1428 – умер после 1470), то понимаем, что он является первым общим предком для двух линий казахских чингизидов, на нем эти две ветки сходятся (одна линия идет от его сына Усека, другая от сына Джадика). Утверждать о том, что это гаплогруппа Джучи мы не будем, так как между ними было еще несколько поколений и нам стоит говорить только о фактах, не идя на поводу у конъюнктурных соображений. То же самое с гаплотипом Даян-хана (1464-1543) (общий предок для всех монгольских чингизидов) – протестировав его потомков, мы будем говорить о гаплотипе Даян-хана, а не о гаплотипе Толуя, Чингиз-хана или Бодончара.

        Насчет гаплотипа Джучи мы сможем говорить что-то более-менее уверенное только после тестирования нескольких линий чингизидов, принадлежащих к его потомкам (например, польских Асанчуковичей, крымских и казахских ханов, а также некоторые российские дворянские фамилии).

        В качестве контрольных линий, способных подтвердить или опровергнуть гипотезу об отцовстве Джучи, можно использовать потомков Бельгутэя и Хасара, братьев Чингиз-хана – известно, что их потомки проживают среди монголоязычных народов. Для непосвященных хотим сказать, что у Чингиз-хана было четыре сына, оставивших многочисленное потомство (Джучи, Чагатай, Угедей, Толуй), из них потомки второго и третьего сына на сегодняшний день отсутствуют.

        Начнем разбор чингизидов.

        Монголы

        Среди монголов проживают потомки Даян-хана (1464-1543). В свое время он оказался единственным чингизидом в Монголии, прошедшим бутылочное горлышко популяции, и все монгольские потомки Чингиз-хана восходят к нему.

        Генеалогия Даян-хана выглядит так [2]:
        он - сын Баян Мунке,
        сына Харгуцага,
        сына Нагбарджи-хана,
        сына Ачая,
        сына Харгуцага,
        сына Усхал-хана,
        сына Тогон-Тимур-кагана,
        сына Кутукту-кагана,
        сына Хашан Кулук-кагана,
        сына Дарма-балы,
        сына Чингкима,
        сына Хубилай-кагана,
        сына Тулуя,
        сына Чингиз-хана.

        Даян-хан выделил уделы всем своим сыновьям (которых у него было одиннадцать). Старшие сыновья стали князьями во Внутренней Монголии (чахарские ханы, в основном представители этой ветви проживают в Китае), младший сын, Гэрэсэндзе, получил в удел Халху. Гэрэсэндзе стал родоначальником таких династий, как Алтан-ханы, Саин-нойон-ханы, Дзасакту-ханы, Тушету-ханы и Сэцэн-ханы.

        Кроме ханов в этой династии было два «буддийских святых» и один известный писатель:
        Лубсан Дамба Джамцан Ундур-геген (1636-1723),
        сын Гомбо Дорджи,
        сына Эрехея,
        сына Абатая,
        сына Нухунуху Уйдзэн-нойона,
        сына Гэрэсэндзэ,
        сына Даян-хана.

        В 1641 году Лубсан Дамба Джамцан был провозглашен хубилганом (перерожденцем) Джебзун Дамба-хутухты. В 1649 году уехал в Тибет, в 1651 году вернулся в Халху, стал ундур-гэгэном (так называли первого богдо-гэгэна). Ундур-геген под именем Занабазар был известен в Монголии как талантливый мастер буддийской скульптуры.

        Второй богдо-гэгэн (1724-1757),
        сын Дондуб Дорджи,
        сына Галдан дорджи,
        сына Чихунь Дорджи,
        сына Гомбо Дорджи,
        сына Эрехея,
        сына Абатая,
        сына Нухунуху Уйдзэн-нойона,
        сына Гэрэсэндзэ
        сына Даян-хана.

        Он был сыном халхаского цинь-вана Дондуб Дорджи, зятя маньчжурского императора Канси, но родился от его второй жены — монголки. Учитывая огромные влияние и авторитет богдо-гэгэнов, маньчжурские правители, опасавшиеся объединения и усиления Халхи, рекомендовали далай-ламе отыскивать будущих «перерожденцев» богдо-гэгэна в Тибете. И действительно, все последующие богдо-гэгэны были «найдены» именно там.

        Натсаг Дорджи (1906-1937),
        сын Дашдорджи,
        сына Лувсанцерена,
        сына Церенчултема,
        сына Самбу,
        сына Церендорджа,
        сына Буянкишига,
        сына Дамдина,
        сына Жамсранжава,
        сына Генденжава,
        сына Ханживдорджи,
        сына Дондуб Дорджи (продолжение рода – см. выше).

        Натсаг Дорджи - писатель, поэт, сценарист. Основатель современной монгольской литературы. Родился в Туве в благородной, но бедной семье. У его отца было только четыре слуги. Был женат дважды: на Пагамдулан и на Нине Чистяковой. От Нины Чистяковой у него была дочь Ананда Шри, которая также имела дочь. С Ниной Чистяковой он познакомился в Военной Академии в Ленинграде. Они поженились, когда он вышел из тюрьмы. В 1935 году его жена и дочь были высланы в Ленинград.

        Среди халха-монголов проживают в основном потомки Гэрэсэндзэ, а потомки остальных детей Даян-хана в основном проживают в Китае, где многие из них носят фамилию Бао.

        Среди монголов проживают много потомков братьев Чингиз-хана, но автор менее знаком с этой темой, поэтому оставим эту часть Чингиз-хановой мозаики нашим монгольским коллегам.

        Калмыки, джунгары, хошоуты.

        Среди западномонгольских племен жила одна династия, которая возводила свое происхождение к Хасару, брату Чингиз-хана. Взлет славы потомков Хасара пришелся на конец XVI - и первую половину XVII веков. Пять сыновей хошоутовского Хаун-нойон-Хонгора от первой жены благодаря своей мудрости и мужеству приобрели большой авторитет среди джунгарских владельцев, и современники с великим уважением называли их «табун-барс» (пять барсов). Старший из них, Байбагас-батур, в 1587 году был признан ойратскими князьями чулган-даргой, т.е. первенствующим среди них по вопросам веры, управления, войны и мира.

        Сын его Очирту-Цецен-хан также признавался соправителем ойратского мира вместе с джунгарским Эрдени-Батуром-хунтайджи. Третий из «барсов», Туру-Байху Гуши-хан, в 40-х годах XVII века откочевал на озеро Кукунор, где создал свое ханство. В эти же годы его войска покорили Тибет. С этого времени Далай-лама приобрел наряду с духовной и светскую власть, а Туру-Байху получил титул Гуши-хана. [3]

        Буряты

        Чингизиды Бурятии происходят от
        Окин-тайши,
        сына Хонтогора,
        сына Цокур Цокту,
        сына Бахарая,
        сына Нухунуху Уйдзэн-нойона,
        сына Гэрэсэндзэ,
        сына Даян-хана (продолжение рода – см. выше)


        Цокур Цокту правил в 1634-1636 в Кукунорском княжестве до его завоевания хошоутами. После разгрома Цокту от хошоутов в Кукуноре, его сын Хонтогор бежал к своим родственникам по матери во Внутреннюю Монголию. В 1696 году ушел из Монголии в Россию находившийся в подчинении у Вачирай Бату Тушету-хана зайсан Окин Хонтогорын, сын Хонтогора.

        Кроме чингизидов в Бурятии проживают родственники Окина по материнской линии, пришедшие вместе с ним. Они являются потомками Бельгутэя, брата Чингиз-хана. Его генеалогия, начиная с последнего потомка:

        Баян Барджигар,
        сын Идэр Нуура,
        сына Дорж Эцэг Дзорикту-вана,
        сына Тумэдэй засага,
        сына Зангуудая,
        сына Сэгусенги,
        сына Тарни Гудэна,
        сына Баясху Бургут-нойона,
        сына Баян-нойона,
        сына Очирхой Дзасакту,
        сына Мулихая,
        сына Мунке,
        сына Табира,
        сына Джошиму,
        сына Наманагца,
        сына Хулу,
        сына Набчин Буру,
        сына Агу Галдзагу,
        сына Энхэ Тогуса,
        сына Мунке Тогуса,
        сына Номохана Буру,
        сына Шихи,
        сына Мэнду,
        сына Бельгутея, брата Чингиз-хана.

        Баян Барджигар был сподвижником Окин-тайши, первого правителя бурят, и не только сподвижником, но и родственником Окин-Тайши по матери. Они прикочевали из Халхи на территорию современной южной Бурятии (Бичурский, Кяхтинский, Селенгинский районы). Он - родоначальник таких родов, как тэмдэгтэн, табантан и табдайтан.

        Потомки Окина и Баян Барджигара живут среди сонголов (один из бурятских родов). Мои попытки взять анализы у представителей этих двух родов закончились таймаутом, все же надеюсь, что кто-нибудь из сонголов пройдет тест.




        Потомки Чагатая и Угедея, а также пакистанцы, индусы, хазарейцы

        Современные потомки второго и третьего сыновей Чингиз-хана, Чатагая и Удегея, официально не известны.

        Последние потомки Угедея правили как марионеточные ханы в державе Тамерлана. К их числу относится Махмуд, который правил в 1388-1402 годах. Его генеалогия согласно Муиззу:

        Махмуд,
        сын Соргатмыш-хана,
        сына Данишменда,
        сына Хундуна,
        сына Турджана,
        сына Малика,
        сына Угедея.

        Возможно, они оставили потомков среди современных узбеков, хотя эти предположения являются гипотетическими.

        Потомки Чагатая составили две ветви: первая ветвь проживала в современном Узбекистане, и ее представители были марионеточными ханами, как и Угедеиды. Эта ветвь известна до второй половины 15-го века, дальше генеалогии этих чагатаидов не были записаны. Хотя шансов на то, что они оставили после себя потомство, гораздо больше, так как их клан был более многочислен чем Угедеиды. Вторая ветвь – это могольская ветвь. Ее основатель Тоглук-Тимур основал в 1347 году отдельное государство Моголистан, где в дальнейшем правили его потомки.
        Его генеалогия:

        Туглук-Тимур (1329-1363),
        сын Эмил-ходжи,
        сына Дува-хана,
        сына Барак-хана,
        сына Есен-Тувы,
        сына Метугена,
        сына Чагатая,
        сына Чингиз-хана.

        Потомки Туглук-Тимура правили Уйгурией до 1696 года. Последний хан Уйгурии Акбаш был из этой династии [4]:

        Мухаммед Мумин-хан (Акбаш),
        сын Саид-Бабы,
        сына Абд ар-Рахима,
        сына Абд ар-Рашид-хана,
        сына Саид-хана,
        сына Ахмеда Алачи-хана,
        сына Йунус-хана,
        сына Вайс-хана,
        сына Ширали,
        сына Хызыр-ходжа-хана,
        сына Туглук-Тимур-хана.

        Некоторые Чагатаиды, как Имин-ходжа (вместе с сыном Масудом), Чин-Тимур, Йусун Тимур, Тухта Буга (четыре сына Ахмеда Алачи-хана) эмигрировали в Индию.

        Кроме них в Индию уехали Баба-султан, сын Халила, сына Ахмеда Алачи-хана, Исмаил-султан, Исхак-султан, Йакуб-султан (дети Шах-Мухаммеда сына Султан-Мухаммеда, сына Султан-Махмуд-хана, сына Йунус-хана). Также в Индию к Камран-мирзе бежал Касим Хусейн, сын Касим-султана [5]. По нашей гипотезе, Касим был сыном Сайдек-хана (сын Хаджи-Мухаммеда), правившего в Сибири и в дни своей юности жившего среди Тимуридов, где, скорее всего, его сын Касим женился на дочери Хусейна Байкары.

        Скорее всего, они оставили потомство в Индии, но искать их потомков в Индии – это искать иголку в стогу сена. Также считается, что пакистанцы и индусы, носящие фамилии Хан, Могол, Мирза могли иметь отношение к Тимуридам, Чагатаидам и другим Чингизидам, переселившимся в Индию.

        Последним же известным Чагатаидом в истории является Мухаммед Ибрагим-бек, который правил в 1781-1794 годах в одном из четырех районов Ташкента [6]. Скорее всего, он чагатаид из могольской ветви, но его точная генеалогия не известна.

        Среди хазарейцев существовала династии потомков персидских ильханов (потомки четвертого сына Чингиз-хана Толуя)

        Родоначальником династии Аргун был Зуннунбек Аргун, сын эмира Хасана Басри и потомок ильхана Аргуна. Он первоначально правил среди хазарейцев до 1507 года, но впоследствии его сын Шахбек бежал от Бабура в Синд, где после него до 1554 года правил сын Шахбека Шах Хасан Аргун. После них на престол взошла другая ветвь потомков ильхана Аргуна, а именно династия Тархан. Основатель династии Иса тархан был сыном мирзы Абду Али, сына мирзы Абду Халика (потомок ильхана Аргуна), после него правили сын Баки и внук Джанибек (сын Баки). В 1591 году династия была отстранена от власти [7].

        Вероятно, потомки этих двух династий до сих пор проживают в Синде. Среди хазарейцев также могли остаться потомки Чагатаидов и Толуидов-ильханов.

        Польско-литовские татары

        Первыми татарами, оказавшимися в Польше и Литве, были татары Кара-Кисека. Кара-Кисек был
        сыном Джеке,
        сына Ногая (знаменитый золотоордынский темник),
        сына Татара,
        сына Бувала,
        сына Джучи,
        сына Чингиз-хана.

        Кара-Кисек после борьбы с Токтой бежал в Польшу, в Краковскую область. Позже другая волна татарских переселенцев пришла с Тохтамышем и его детьми. Сын Тохтамыша Джелаладдин участвовал в Грюнвальдской битве на стороне Витовта и Ягайла. Именно легкая татарская конница своим первым натиском, а потом притворным отступлением помогла полякам и литовцам одолеть Орден.

        В 1455 году младший сын Тохтамыша Сеид-Ахмед попал в плен к Казимиру. Он был поселен в Ковно (Каунас), девять его сыновей осели среди польских татар [8].
        Один из его сыновей Джанибек смог на время вернуться в степь, где на два года стал ханом в Крыму [9]. Еще два сына Сеид-Ахмеда, Воймин и Кирко, известны по литовским источникам. Мы считаем, что царевичи Пунские были по происхождению от детей Сеид-Ахмеда, так как они имели статус царевичей, хотя также нам не известно, какую фамилию носило многочисленное потомство Сеид-Ахмеда. Такое отнесение Пунских имеет под собой основания, хотя и возможны другие варианты. Ветвью Пунских были Гиреевские, происходящие от Ислам-Гирея Пунского. Пунские существовали в Великом княжестве литовском до конца XVII в.

        По семейной легенде к чингизидам относились также Бердибековы. По легенде сын Бердибека уехал сначала в Крым, а потом в Литву. Имя его неизвестно. Потомок Бердибека Иван Бердибекович оставил трех сыновей – Мишка, Семена и Павла, упомянутых в 1470-95 годах в актах метрики Литовской. Павел был жив еще в 1528 году. У него было два сына Петр и Грегорий, известных по описи 1567 года.

        Следующей семьей, потомками чингизидов, были Острынские, происходящие от сына последнего хана Большой Орды Узбека Шейх-Ахмедовича. 11 апреля 1514 г. Сигизмунд I известил острынского наместника о пожаловании царевичу Узбек (Азубек)-солтану 70 конюхов, 6 пустошей и двух паробков под Острыной (Лидский повет). По местоположению этого имения (позже известного как Рыча) Узбека и его потомков стали именовать царевичами Острынскими.

        После возвращения хана в Орду Азубек-солтан оставался в Литве (первоначально, видимо, в качестве одного из заложников, вместе с ханским братом Халлеком и упоминавшейся выше женой Шейх-Ахмеда) [10]. В начале 17-го века род Острынских пресекся.

        Польско-литовские татары делились на шесть групп: Баргын (Барын), Джалаир, Юшинь (Уйсун), Конграт, Найман, и Улан.

        Из этих шести групп пять были племенами Золотой Орды, а слово Улан происходило от названия Оглан (титул, который носили представители рода Чингиз-хана). В Великом княжестве литовском было много уланских родов. Уланов от царевичей Острынских и Пунских отличал статус: Острынские и Пунские происходили от золотоордынских ханов Шейх-Ахмеда и Сеид-Ахмеда (есть версия что Пунские происходят от крымских ханов), в то время как уланы происходили от прочих чингизидов, не правивших Золотой Ордой.

        На основании книги Дъядулевича [11], дадим короткое резюме по уланским (чингизидским) родам среди польско-литовских татар:

        Самым большим уланским родом были Асанчуковичи. По информации, доступной в Интернете, род Асанчук происходит от Кара-Кисека, внука Ногая, но в литературе эта версия не нашла подтверждения. Асанчук известен в 1425-1430 годах, он и его потомки владели имением Засуле, близ Минска. У него было четыре сына – старшего звали Шатыш (упомянут в 1460 году), имена двух средних сыновей неизвестны, младший – Чадет-улан (упомянут в 1480 году)

        1. Шатыш

        Сыновьями Шатыш-удана были Войшутко (1482), Майко (1487-1520), Сеит (1487).

        1.1. Войшутко.

        Сыном Войшутко был Ахмет. У него было три сына

        1.1.1. Хасан, предок таких родов, как Засульские, Ждановичи, Хасеневичи. У него были следующие сыновья: Алей, Фурс (женился на Умнее Ширинской, вдове Чингиза Острынского), Махмет, Ахмет, Шахун. Махмет, Ахмет и Шахун унаследовали Засулу от Аликеча из другой ветви Асанчуковичей.

        Алей имел сына Хасана, который положил начало роду Хасеневичей. У Хасана было два сына Шахун и Ждан (родоначальник Ждановичей)

        У Фурса был сын Агиш.

        1.1.2. Шахун, предок таких родов как Шагуневичи (Шахуновичи), Чимбаевичи герба Варния.

        1.1.3. Шахдовлет, у которого была два сына: Чимбай, предок рода Малушицких (Малучицкие), и Шахун, предок рода Чимбаевичи герба Вардан.

        1.2. Майко
        Другой сын Шатыша, гродненский маршал Майко имел четырех сыновей: Махмета, Бегима, Адка, Нурума, которые поделили Засуле. В 1522 году Сигизмунд утвердил раздел Засуле. Сын Бегима Аликеч, известный королевский ротмистр, поменял часть Засуле на часть Довбучисек.

        Нурум стал предком Нурумовичей, а Адка стал предком Корицких..

        1.3. Сеит

        У Сеита была два сына: Касым и Юхна. Касым не оставил потомства, а Юхна стал предком Лостайских.

        2. Второй сын Асанчука не известен по имени. Его сыновьями были Урус и Тулаш, упомянутые в 1506 году, а также Кодзел.

        2.1. Сыновьями Уруса были Ахмет, Асан, Халим, Абрагим, и возможно Урмаш (предок Халецких). Сыном Абрагима был Измаил, предок Измаиловичей.

        Асан положил начало таким родам как Демидковские, Шемешовы.

        У Ахмета был сын Яхья, у Яхьи был сын Сафьян. У Сафьяна были дети Рызван и Ильяс, положившие начало родам Ильяшевичи и Рызвановичи.

        2.2. Сыновьями Тулаша были Майко и Дисо.

        3. Третий сын Асанчука тоже не известен по имени. Его сыновьями были Обдула, Банко, Дахно, Кодзел.

        3.1. Сыном Обдулы был Давлеш. Сыновьями Давлеша были Исуп и Михно, положившие начало роду Романовских.

        3.2. Банко. У Банко были три сына Келим, Киль Довлет и Ян Довлет.

        3.2.1. Келим стал предком Шабановичей.

        3.2.2. Киль Довлет. Его сын Измаил в 1565 году был на военной службе в литовском войске. Его сыновьями были Муртаза, по прозвищу Альдзиук (предок Альдукевичей), и Абдыш, предок Абдзевичей.

        3.2.3. Ян Довлет. Его потомки носили фамилию Улановы. Его детьми были Богдан, Джанибек и Ахмат (предок Ахматовичей).

        3.3. Сыном Дахно был Джанибек.

        3.4. Сыновьями Кодзела являлись Ивашко и Аликеш. У Ивашко был сын Алей, на котором род Кодзелевичей пресекся.

        4. Сыновьями Чадет-улана были Чогадай, Мысак и предположительно Михно

        4.1. Чогадай. У него было два сына Миско и Федор. От Миско пошли два рода: Чугаевичи и Йозефовичи.

        4.2. Михно. Сыновьями Михно были Фурс, Анджей, Михайло, Бахтияр.
        Михайло и Бахтияр положили начало таким родам как Волкачовы-Каецинские и Мочинские.

        4.3. Мысак. У него было три сына: Янушко, Ромодан, Махреш.
        Янушко стал предком Рудзиевичей, а Ромодан и Махреш стали предками Мысаковых.

        Также к Асанчуковичам относят:

        1. Дайковы: предок Часиен Дайко фигурирует в гродненских актах 1591 года. Возможно из рода Халецких, либо из другой ветви Асанчуковичей.

        2. Москевичи, подрод Рудзиевичей.

        3. Поланские-Улановы, потомки Александра Улана из рода Улановых (1769)

        4. Дракевские, ветвь Халецких.


        Другие уланские рода

        1. Алинские и Лосинские: Предок Войняк, отец Баранка, служившего в войске литовском в 1528 году.

        2. Андреевичи (Анджеевичи): предок Анджей Михнович был в войске литовском в 1528 году.

        3. Аразлич: Предок - Аразла, его сын Шиман фигурировал в описи войска литовского в 1528 году.

        4. Байрамсубовичи: предком рода был Ураз, сын которого в 1558 году фигурирует в войске литовском.

        5. Балдышевичи (Болдышевичи): Потомки Болдыша, известного по описи войска в 1567 году.

        6. Бобикевич: Потомки Тавучука, сын которого, Сепук, известен по описи войска в 1567 году.

        7. Богушевские (Богушевичи): предок Корсак-улан известен по описи 1528 года, был приписан к Ушинской хоругви.

        8. Бузуновы и Карзаевичи, Давлешовичи: происходят от Чодыра, отца Богдана и Давлеша, известного по описи 1528 года.

        9. Манкозич: предок Манкожа, отец Татлукожи.

        10. Данкевичи: Предок Даниел, отец Кудайбердыя, Кансубы и Черевчея, известных по описи 1559 года.

        11. Идресевичи: предок Идрис известен по описи 1559 года.

        12. Есинские, Речиповичи, Смольские-1, Шахмансеровы: происходят от Сеинчука, отца Араза, известного по описи 1528 года. Сыновья Араза: Богдан, Адам, Януш (предок Речиповичей и Смольских) и Кульзиман (предок Есинских).

        13. Лосовские: предок Белексуба, отец Кудаша.

        14. Мурзичи: предок Итеш, отец Мурзы.

        15. Ебеловичи: предок Ебел, сын которого Ильяр известен по описи 1528 года.

        16. Качкаровские: предок Качкар, отец Матиаса, известного по описи 1528 года.

        17. Корсаки: потомки Адама-улана.

        18. Козакевичи и Козаковские: потомки Янко (конец 15 века), отца Монтуша.

        19. Некрашевич: предок Некраш, известный по описи 1507 года.

        20. Козловские: предок Ямгурчи, известен в описи 1506 года

        21. Кульбицкие: предок Евизах, отец Мака

        22. Кункевичи: предок Тулаш, отец Курмаша, известного по описи 1528 года.

        23. Курмаш: предок Борко, отец Курмаша, известного по описи 1528 года.

        24. Лехушевич: предок Лехуш, отец Богдана.

        25. Левачковы: предок Базар, отец Шемардена.

        26. Лихачевы: предок Курманчик, отец Аксубы.

        27. Ломаковы: предок Жук, отец Айзюка

        28. Потушинские: предок Дармаш, отец Потуша.

        29. Селимшовы: предок Осман, отец Селимши.

        30. Смольские-2 и Шемерденовичи: предок Чутур, отец Шемердена.

        31. Собачкевичи: предок Собачко, отец Азко и Богдана.

        32. Солтыковы: предок Канчем, отец Солтыкана.

        33. Сулеймановичи: предок Яныш, отец Янсубы.

        34. Счезновичи: предок Исуп, отец Счестного

        35. Тансаревичи: предок Тан Сарей.

        36. Тулубай и Великие: предок Тулубай, отец Тактамы.

        37. Здзиекельские: предок Якоб Туча.

        38. Анбокевич: предок Джанибек Чутурович (1534)

        39. Баранцевичи: предок Асан, отец Баранца (1528)

        40. Блоки (Бялоблоки): предок Чобонаш, отец Болотко

        41. Богдашевские: предок Янушко, отец Богдаша (1511)

        42. Бохдзиевичи: предок Бохдзей, отец Исупа (1528)

        43. Булатовичи: предок Булат, отец Богдана.

        44. Давидовские: предок Давид, отец Мустафы (1528)

        45. Дзядулевичи: предок Дзядуллах, отец Ахмета Дзядулина, известного по актам 1489-1500 годов. К этому роду принадлежал Станислав Дзядулевич.

        46. Гудзиевские: предок Собол, отец Ариты (1528)

        47. Харабурдовы и Щербовы, Жукевичи: предок Тахир (1442), отец Хамзы (1480)

        48. Киневичи: предок Киен (1511)

        49. Коцановы: предок Коцан.

        50. Коморовские: предок Янек, отец Анджея и Матея (1567)

        51. Косякевичи и Соколовские: предок Иван (1528), отец Косяка и Базара, по прозвищу Сокол.

        52. Мордасевич: предок Мордас, отец Абрагима

        53. Османовичи и Османовские: предок Солтыш, отец Бордзилы (1528)

        54. Руневичи: предок Рын, отец Богдана.

        55. Шпаковские: предок Ромодан, отец Махмета (1528

        56. Шийковские: предок Байдаш, отец Базара.

        57. Татаровские и Вербицкие: предок Залеско, отец Бордзила (1540)

        58. Токарские: предок Кансуба (1550), отец Аксубы

        В роду Уланов самым знаменитым был ротмистр Александр Улан. Получив звание полковника, он был фаворитом Августа III. Во время гражданской войны 1715-1716 годов он воевал на стороне короля. Король оценил это и перевел весь полк Александра Улана, состоящий из восьми хоругвей, в количестве 400 человек, в польскую армию, где этот полк выполнял функции королевской гвардии. После смерти Александра командование полком поручили полковнику Чымбаю Мужи Рудницкому (тоже из уланского рода), который вскоре стал генерал-майором. Полк был назван уланским, в честь Александра Улана, а впоследствии это название было перенесено на все татарские полки. Чымбай умер на войне в 1762 году [12].

        Мы взяли анализ у представителя рода Ахматовичей, но при дальнейшем рассмотрении узнали, что было два рода Ахматовичей, и человек, сдавший анализ, принадлежал ко второму роду Ахматовичей, происходившему из Заволжской Орды, из племени ушин (хушин, уйсун). Его анализы оплачены, и мы находимся в ожидании результатов. Также нам интересны результаты анализов семьи Фурсов, участвующих в проекте «Генография фамилий: однофамильцы или родственники», которых некоторые исследователи относят к Асанчуковичам.

        К сожалению, мои обращения к 20 представителям уланских родов, проживающих в Беларуси, не дали результатов. Ни один из них так и не согласился сдать анализ (оплату анализов мы брали на себя).


        Румынские потомки Чингиз-хана

        Тохтамир – основатель валашского государства, отец Бессараба. Годы правления (ок.1290-ок.1310)

        До недавнего времени в румынской историографии было две версии о происхождении Тохтамира. Некоторые историки идентифицируют его с болгарским боярином по имени Тихомир. Но другие исследователи (Aurel Decei) склонны идентифицировать его с Тохтамиром (Ток-Темир), из рода Чингиз-хана, известного по походам на Русь.

        В английской историографии распространено мнение о Чингизидском происхождении Бессараба, это позволяет им вывести родство почти всех европейских домов с Чингиз-ханом.

        Neagu Djuvara имеет свой взгляд на проблему, считая Тохтамира и Басараба куманами, приводя свою систему доказательств [13].

        Известный британский криптоисторик и специалист по генеалогии и культурологии Лоренс Гарднер в своей книге прямо указывает на то, что Бессараб – правнук Чингиз-хана [14].

        Мы отождествляем Тохтамира с
        Тохтамиром, сыном Кукджу,
        сына Беркечара,
        сына Джучи,
        сына Чингиз-хана

        на следующих основаниях:

        1. Билыкчи, брат Тохтамира, был тем человеком, кто помог Тохте занять трон. В благодарность за это Тохта мог подарить часть бывшего удела Ногая Тохтамиру.

        2. Правление Тохтамира в 1290-1310 годах в Валахии не могло иметь места, так как в это время данные территории входили в состав Золотой Орды, и ими могли управлять только принцы-джучиды как наместники хана Тохты (как известно, Тохтамир назван как наместник, а не король в легендах, правда, непонятно, чьим наместником он был по легенде). После смерти Ногая Тохта разделил земли Ногая между своими родственниками: Тукель-буга сел в Исакчи, у Железных Ворот в Валахии, т.е. в дунайских землях, а Ильбасар - на Нижнем Урале. Возможно, другие земли Ногая были переданы другим родственникам Тохты. Возможно, Тохтамир получил Валахию на правах наместника Тохты. Thocomerius по легенде был первым наместником Валахии, но в то время власть Золотой Орды была очень сильна, и вряд ли кто-нибудь смог бы получить эту землю без разрешения хана. Тем более мы видим, что до 1324 года Валахия была слабым государством, которое подчинялась соседям.

        3. Отделение Тохтамира и Бесараба от Золотой Орды, скорее всего, связано с исламизацией в Золотой орде, гражданской войной против немусульман, а также репрессиями Узбека против джучидов. После смерти Тохты в 1312 году в Золотой Орде началась гражданская война. Племянник Тохты Узбек совершил переворот, убив наследника Тохты Ильбасара и эмира Кадака. После переворота сразу были казнены 120 царевичей из рода Чингиз-хана [15]. Узбек был мусульманином и усердно начал исламизацию страны (он был узурпатором, и ему пришлось опереться на мусульманскую оппозицию). Многие несогласные с политикой Узбека начали выезжать на Русь. Возможно, Тохтамир или Бессараб как близкие родственники хана, опасаясь за свою жизнь, решились жить в Валахии, не вмешиваясь в гражданскую войну. Если монголы-христиане бежали на Русь, то вполне можно предположить, что часть их (к которым могли относиться Thocomerius и Бессараб) могли уйти в Валахию и под защиту Венгрии (Валахия до 1324 года была вассалом Венгрии). Среди монголов было много христиан (например, Сартак, хан Золотой Орды был христианином) [16].

        Иоанн Бессараб, сын Тохтамира, положил начало династии Бессарабов. В честь Иоанна Бессараба был назван географический район Бессарабия. Династия Бессарабов по мужской линии пресеклась в 17 веке.

        Самым известным представителем династии Бессарабов стал Влад Дракула, или

        Влад Цепеш Дракула (ноябрь, декабрь 1431-декабрь 1476),
        сын Влада III,
        сына Мирчи Старого,
        сына Раду Черного,
        сына Александра,
        сына Иоанна Басараба.

        Через Бессарабов многие европейские дома возводят происхождение к Чингиз-хану:

        1. Александр, сын Иоанна Басараба, отдал свою дочь Елизавету за Владислава Оппельна. Их дочь Катерина фон Шлесен Оппельн вышла замуж за Генриха Сагана. Их сын Иоганн I Саган является предком многих европейских домов. Среди его потомков – Луиза Вильгельмина (1817-1898), супруга Кристиана IX Ольденбурга. Их потомками являются королевские дома России (Николай II и его братья и предки), Греции (Георг I), Норвегии (Хакон VII), Дании (Фредерик VIII), Бельгии (Балдуин I), Испании (София, жена Хуан Карлоса).

        2. Сын Влада Цепеша Дракулы, Михня I, выдал свою внучку Поликсену замуж за Марко Якша. Ее потомок – Клодин Сьюзан Редей, бабушка Марии Тек, супруги Георга V Виндзора. Среди ее потомков есть правящий дом Великобритании.

        Еще одним родом чингизидского происхождения мог являться род Кантемиров.
        Согласно семейной легенде, Кантемиры происходят от хана Белгородской орды Темира, который в 1540 году принял христианство и поселился в Молдавии. Местные жители произносили "хан Темир" как "Кантемир" - отсюда и фамилия. Проблема в том, что историки не знают о существовании Белгородской Орды. Возможно Темир был одним из Ногайских ханов, чье имя не сохранила история, так как историков того времени интересовали больше «не куклы, а кукловоды». Тогда его переселение сродни переселению Ахмед-Гирея, сына казахского Хак-Назара, на Кубань из-за развала Ногайской Орды в 1550-60-х годах [17].

        По другому источнику, княжеский род Кантемиров происходил от богатого татарина Кантемира, в 1540-м году принявшего христианство и поселившегося в Молдавии. Шансов на то, что Кантемиры были чингизидским родов, 50 на 50. Если они происходили от хана, то их чингизидское происхождение не оспаривается, так как только чингизиды имели исключительное право именоваться ханами. Если же они происходили от татарского богача, то тут, скорее всего, никакого чингизидства нет. Мужская линия рода пресеклась в 1820 году.





        Русские потомки Чингиз-хана

        К потомкам Чингиз-хана мы относим те фамилии, родоначальники которых значатся в русских источниках как царевичи или уланы (огланы)

        1. Чириковы.

        Первым чингизидским родом на Руси стали Чириковы. Его основателем был Петр Ордынский, племянник Бату и Берке. Ростовский епископ Кирилл, которого современники называли блаженным и учительным, приходил в Орду к хану Бату. В числе слушателей беседы епископа с ханом был юный племянник Бату, сын его брата Даир. Он был впечатлен проповедями Кирилла. Во время вторичного пребывания епископа в Орде Даир решился удалиться с ним в Ростов, чтобы там принять крещение, и назвался Петром. Даир-Петр купил земли возле озера для основания монастыря, и на земли, предоставленные храму и царевичу, князь Борис выдал грамоты.

        Петр прожил в супружестве много лет, имел детей. В глубокой старости, овдовев, он принял монашество в основанной им обители и мирно умер около 1290 года. Был похоронен в построенной им церкви. Официально он был причислен к лику святых на Соборе 1547 года при митрополите Макарии. Когда Петр Ордынский купил землю у князя Бориса, тот, хорошо зная нравы своих соотечественников, не только продал, но и выдал грамоты на землю. Петр не понимал, зачем и какие грамоты требуются на землю, в этом проявлялась его ментальность как кочевника. Эти грамоты были впоследствии предметом спора между потомками Петра (Лазарь Петрович, Юрий Лазаревич) и князьями Ростовскими.

        Игнатий Юрьевич благодаря своему происхождению смог защитить Ростов от нашествия Ахмыла. Сын Игнатия Петр служил Дмитрию Донскому и участвовал в Куликовской битве. Был основателем рода Чириковых. Его потомок Дионисий (1440-1502) был знаменитым иконописцем. Дионисий украшал фресками и иконами московский Успенский собор. Художника особенно ценил великий князь Иван III, который щедро оплачивал его работу [18].

        2. Аничковы.

        Потомки царевича Золотой Орды, Берке, выехавшего к Ивану Калите в 1301 году. Берке был крещен митрополитом Петром и назван Аникеем. Женился на дочери Викулы Воронцова, сын Юрий.

        3. Серкизовы и их ветви Старковы и Чебышевы.

        Родоначальник – Серкиз, сын Ахмета. Царевич Серкиз переехал в Москву во время правления Дмитрия Донского в 1371 году. При крещении он принял имя Иван. С 1378 года известно село Черкизово, принадлежащее Серкизу-Ивану. Его сын Андрей (?-1380) был героем Куликовской битвы (командовал одним из шести полков), где и погиб.

        4. Мертваго.

        Произошли от Благодена (Бильгитдина), царевича Золотой Орды, вышедшего в начале XV века к Олегу Рязанскому (1342 – 1402). Его потомки будто бы сохранили титул царевичей, а при Грозном сироты одного из них названы были детьми Мертваго царевича (имя царевича просто долго не могли вспомнить). После этого за ними закрепилась фамилия Мертваго.

        5. Булгаковы.

        К ним относят три фамилии Булгаковых разного происхождения. Генеалогия одной известна, о других двух ничего нельзя сказать.

        Шай, «муж честен и храбр» (во св. крещении Иоанн), племени ханского, выехал со многими людьми к великому князю Олегу Рязанскому (1342—1402). Потомок его, Матвей Денисович Булгак, находился воеводою в войске, посланном разорять улусы детей Ахмета-хана в 1501 г., потом был воеводою в Белеве в 1507 году и Рязани в 1520 и следующих годах. От него пошли рязанские Булгаковы.

        6. Талычевы.

        Потомки Талыча, ордынского царевича, в 1410 году перешедшего на службу к нижегородскому князю Даниилу Борисовичу и совершившего вместе с ним поход на Владимир.

        7. Чалымовы.

        От астраханского князя Чалым-улана и его сына, вышедших на русскую службу в 1557 году. Чалым был противником Измаила, правителя Ногайской Орды (не путать с Джалимом, казахским султаном, жившим в то же время и воевавшим с ногаями). Чалымовы, скорее всего, относились к Астраханской ветви джучидов. К этой же династии относился русский царь
        Саин-булат (Симеон Бекбулатович) (?-январь 1616),
        сын Бек-Болата,
        сына Бахадура,
        сына Ахмад-хана,
        сына Кичи-Мухаммед-хана,
        сына Тимур-хана,
        сына Тимур-Кутлук-хана,
        сына Тимур-хана,
        сына Кутлук-Тимура,
        сына Нумкана,
        сына Абая,
        сына Уран-Тимура,
        сына Тука-Тимура,
        сына Джучи,
        сына Чингиз-хана.

        Царь Иван Грозный «соблаговолил поставить на престол Москвы в качестве царя Симеона Бекбулатовича; он сам принял имя Иван из Москвы, покинул город и поселился в пригороде Москвы по названию Петровка». Иван передал Симеону свой весь «честной» двор и, как простой боярин, использовал карету-повозку со сбруей. Каждый раз, когда он приезжал видеться с новым царем Симеоном, он отказывался сидеть на троне и садился в отдалении от бояр.

        «Симеон Бекбулатович оставался Великим Князем России меньше чем год; после этого царь Иван назначил его Великим Князем Твери и сам опять стал царем Москвы». Царь Борис Годунов внимательно наблюдал за Симеоном и его сыновьями. Более того, он, по-видимому, ослепил его. Симеон Бекбулатович ослеп на свой день рождения после питья испанского вина, присланного царем Борисом с его сопроводительным письмом. Слуга Симеона, который пробовал то вино, также потерял зрение.

        Годунов не позволял непосредственно общаться с Симеоном, но всегда его боялся, поскольку после смерти царя Федора Ивановича (Федора I) группа влиятельных бояр во главе с Федором Романовым и Богданом Бельским открыто заявили о своем желании видеть в качестве царя России или Симеона Бекбулатовича, который уже занимал трон во время правления Ивана Грозного, или его старшего сына князя Федора, который был потомком как Ивана III, так и Гедимина.

        В марте 1606 Лже-Дмитрий I направил наставнику монастыря Св. Кирилла в Белозерском письмо, содержащее приказ заключить Симеона Бекбулатовича в качестве монаха тем же образом, как и его тестя князя Мстиславского. В исполнение этого приказа прежний царь Симеон стал «монахом Степаном». В тоже время его жена царица Анастасия была принуждена стать монахиней. Она умерла в 1607 и была похоронена под именем «сестры Александры». Лже-Дмитрий I был склонен удалить Симеона Бекбулатовича по нескольким причинам. Главной из них было то, что Симеон продолжал рассматриваться как кандидат на трон России.

        После убийства Дмитрия и победы князей Шуйских новый царь Василий Шуйский (Василий IV) приказал наставнику монастыря Св. Кирилла в Белозерском привести к его послу Федору Суконеву монаха Степана, который «был прежним царем Симеоном Бекбулатовичем». Последний был переведен в Соловецкий монастырь на крайнем Севере, где он прожил шесть лет в исключительной нищете. После восшествия на трон Михаила Романова в 1613 царь Симеон, по-видимому, получил разрешение покинуть монастырь Святого Кирилла, поскольку он умер уже в Москве в январе 1616 и был похоронен около своей жены в монастыре Св. Симеона. Он имел трех сыновей, Федора, Дмитрия и Ивана, и трех дочерей, Евдокию, Марию и Анастасию. Они, по-видимому, умерли насильственной смертью, поскольку известно, что Симеон Бекбулатович пережил всех своих детей.

        8. Сибирские.

        Потомки сыновей сибирского хана Кучума - Али, Абулхаира, Кумыша и Алтаная - до 1718 года носили титул царевичей сибирских (кроме одной ветви - потомства Хансюфа Алеевича, - уже в первой половине XVII века имевшей лишь княжеский титул) и пользовались при дворе некоторыми почестями.

        Последними представителями этого рода были Александр Васильевич Сибирский (1779-1836), участник войны 1812 года, позже генерал-лейтенант, имевший много наград за воинскую доблесть. Его сын - Александр Александрович Сибирский (1824-1879), известный археолог и нумизмат.

        Для ясности приведем генеалогию Кучума:

        Кучум,
        сын Муртазы,
        сына Кулука,
        сына Ибак-хана,
        сына Махмудек-хана,
        сына Хаджи-Мухаммед-хана,
        сына Али,
        сына Бек-Кунды,
        сына Менгу-Тимур-хана,
        сына Бадакула,
        сына Джучи-Буки,
        сына Бахадура,
        сына Шибана,
        сына Джучи,
        сына Чингиз-хана.

        9. Касимовские цари.

        Происходили как царевичи сибирские от Кучума. Последний касимовский царь был Василий (?-1715),
        сын Ивана,
        сына Михаила,
        сына Сеид-Бурхана,
        сына Алп-Арслана,
        сына Али,
        сына Кучума.

        Василий правил в 1691-1715. Был царем по имени, не обладая реальной властью.

        Следующие рода происходят от Улуг Мухаммеда, и поэтому мы укажем генеалогию Улуг Мухаммеда:

        Улуг Мухаммед,
        сын Хасана,
        сына Джансы,
        сына Тулек-Тимура,
        сына Кунчека,
        сына Саричи,
        сына Уран-Тимура,
        сына Тука-Тимура,
        сына Джучи,
        сына Чингиз-хана.

        10. Абашевы.

        Потомки Абаша Улана - воеводы казанского хана Мухаммеда Эмина, в 1499 году перешедшего на русскую службу. Скорее всего, Абаш-улан был из потомков Улуг Мухаммеда, так как в это время большинство чингизидов из Казани были потомками Улуг Мухаммеда.

        11. Мустафины.

        Родоначальник - Муртаза Мустафин, сын Мустафы, сына Улуг Мухаммеда. Казанский царевич. Его отец Мустафа в 1444 году вторгся в Рязань, но был убит русскими при отступлении. Муртаза перешел на службу к русскому князю. Иван III, отправляясь в поход на Новгород, оставил управлять землею и стеречь Москву татарского царевича Муртазу. В 1469 году Муртаза был упомянут на стороне русских. В 1474 году Иван отдал царевичу Муртазе новый городок на Оке со многими волостями.

        12. Бахметьевы (Бахметовы).

        Происходят от Аслама Бахмета (в крещении Иеремей), выехавшего в первой половине XV века на службу к Великому князю Василию Васильевичу Тёмному вместе с братьями Касимом и Якубом. Все трое были сыновьями Улуг-Мухаммеда.

        13. Долголядские.

        Родоначальник - Федор Долголядский (1484-1538),
        сын Мелик-Тагира,
        сына Ибрагима,
        сына Махмутека,
        сына Улуг-Мухаммеда.

        Федор в детстве был крещен. Был убит Василием Шуйским за то, что мешал ему жениться на племяннице Федора Анастасии, дочери Петра Казанского и сестры великого князя Елены Иоанновны. Русская Православная Церковь канонизировала Федора и признала страстотерпцем.

        14. Максудовы.

        Род происходит от князя Максуд-оглана, из потомков Касим-хана, сына Улуг-Мухаммеда. Максуд умер в 1554 году, его сын Айдар Максудов умер в 1594 году. Это единственные потомки Улуг-Мухаммеда, которые не стали русскими, а остались татарами.

        15. Потомки Петра Казанского:

        Кудай-кул (Петр Казанский) (?-1523),
        сын Ибрагима,
        сына Махмутека,
        сына Улуг-Мухаммеда.

        Царевич Кудай-кул был захвачен в плен в 1487 году русскими, взявшими Казань. Он вырос в русском плену, впоследствии был доставлен из ссылки в Москву и освобожден из-под ареста. 21 декабря 1505 года его торжественно крестили на Москве-реке с именем царевича Петра Ибрагимовича. Через неделю, 28 декабря, царевич Пётр дал запись великому князю Василию III в том, что он будет служить ему верно, а еще через две недели, 15 января 1506 года молодой царь отдал Петру в жёны свою 14-летнюю сестру Евдокию (младшую дочь великого князя Ивана III от его второй жены Софьи Палеолог). Евдокия и Пётр были обвенчаны в Успенском соборе московского Кремля архимандритом Спасского монастыря Афанасием.

        Для Василия III царевич Петр был не просто родственник. Он стал его ближайшим сподвижником, верным и надёжным другом. Более того, московский великий князь видел в нём своего преемника. Бездетный Василий III перед походом на Псков в 1509 году написал завещание, согласно которому в случае его гибели престол должен перейти к царевичу Петру. Покидая на время Москву, великий князь всё чаще доверял управление и защиту столицы своему зятю.

        У Петра--Худай-Кула было две дочери, обе по имени Анастасии. Старшая из них была замужем за кн. Федором Михайловичем Мстиславским, младшая - за кн. Василием Васильевичем Шуйским. У А. П. Мстиславской был сын Иван Федорович, дочь которого Анастасия Ивановна вышла замуж за бывшего Касимовского хана Саин-Булата, крестившегося с именем Симеона Бекбулатовича. У А. П. Шуйской была дочь Марфа Васильевна, бывшая замужем за кн. Дмитрием Ивановичем Бельским.

        Татарские потомки Чингиз-хана

        1. Чанышевы.

        Представляя в 1828 г. в Герольдию Правительствующего Сената прошение об утверждении в княжеском достоинстве, князь Владимир Александрович (до
        крещения – Сулейман Ибрагимович) Чанышев утверждал, что род князей
        Чанышевых происходит от Чингисхана. Прямым их предком он назвал Алтун-
        хана и ханшу Гурьлявич. Согласно нашей версии [19], предком Чанышевых был Алтун-бик, которого Сулейман Чанышев мог принять за алтун-хана, мифического предка самого Чингиз-хана. Как нам известно, Алтун-бик был правителем Казани, после него правил его брат Алим-бик и уже потом власть захватила династия Улуг Мухаммеда. Согласно татарским шежере отцом братьев назван булгарский хан Абдулла, который не известен по летописям. Мы отождествляем этого Абдуллу с мамаевским Абдуллой, марионеточным ханом, от чьего имени правил Мамай. Абдулла был либо сыном Узбек-хана («из отроков Узбек-хана»), либо его внуком (сын Хидырбека, сына Узбека – версия Сафаргалиева). Как известно в 1370 году в Мамаевой Орде умер Абдулла-хан, на его место сел Мухаммед Булюк. В том же году он с помощью русских войск захватил Булгар. Вполне возможно, что он выделил сыновьям покойного хана Абдуллы во владение Казань.

        Представители рода Чанышевых широко известны в Татарстане. Один из этого рода дал принципиальное согласие на прохождение ДНК-теста, но из-за почты наше ожидание несколько затянулось. Также известно, что у Алим-бика были тоже дети, и одним из его потомков был Тажетдин Ялчыгол, записавший шежере своей семьи.

        2. Потомки Юрматы-бия.

        Согласно нашей точки зрения, в статье «Ногайские ханы и Башкирия» [20] Юрматы-бий является потомком Шибанидов, и родоначальник рода Юрматы-бия - потомок шибанидов Аеры Калбак,
        его сын Абужай-хан,
        его сын Исмаил-хан,
        его сын Алмалы,
        его сын Юрматы-би,
        его сын Юрми-би,
        его сын Гали-би,
        его сын Алеем Аккучкар и т.д.

        С более полной генеалогией рода можно познакомиться в книге «Татар шежиресы» Марселя Ахметжанова.

        Абужая мы отождествляем с Абак, он же ногайский хан Абогай, чья дочь вышла замуж за крымского хана Саадат-Гирея. Его генеалогия такова:

        Абак,
        сын Ядигера,
        сына Тимур-шейха,
        сына Тимур-ходжи,
        сына Араб-шаха,
        сына Пулада,
        сына Менгу-Тимура,
        сына Бадакула,
        сына Джучи-Буки,
        сына Бахадура,
        сына Шибана,
        сына Джучи,
        сына Чингиз-хана.

        3. Потомки Кара-бика.

        Шежере Кара бика выглядит так:
        Кара-бик,
        сын Канбар-бика,
        сына Калдар-бика,
        сына Балым-бика,
        сына Бачман-хана.

        Были попытки сопоставить предка Кара-бика Бачмана с кипчаком Басманом, воевавшим с будущим правителем Монгольской империи Мунке. Но четыре поколения никак не вписываются в шежере. Согласно же моей точки зрения, мы можем отождествить Бачмана, предка Кара-бика, и Баджмана из потомков Чимпая, сына Джучи (он фигурирует в Нусрат-наме) [21]


        Каракалпаки

        1. Кучумовичи.

        Среди каракалпаков могли остаться потомки сибирского хана Кучума, которые там правили. Основателем династии был

        Кучук,
        сын Абулая,
        сына Ишима,
        сына Кучума.

        У Кучука был сын Султан-Мурат и племянник Ишим, правившие среди каракалпаков[22]. Позже эта династия была отстранена от власти казахскими чингизидами.

        2. Каракалпакские торе.

        По устной информации, полученной от потомков казахских торе в Каракалпакии, там есть две линии торе, потомки братьев Каип-хана и Бори-торе. Они были сыновьями

        Батыр-хана,
        сына Каип-хана старшего,
        сына Ксрау,
        сына Сырдака,
        сына Кудайменде,
        сына Ишим-хана казахского,
        сына Шигай-хана,
        сына Джадика,
        сына Джанибек-хана казахского (его генеалогию и гаплотип мы рассмотрим ниже в главе про казахских торе).

        К потомкам Каип-хана относился последний хан каракалпаков Мухаммед Зарлык-торе,
        сын Абулгазы,
        сына Каип-хана [23].


        Крымские Гиреи.

        В 15-м веке двоюродный брат Улуг-Мухаммеда, Хаджи-Гирей основал династию крымских ханов, существующую и поныне. Его генеалогия:

        Хаджи-Гирей,
        сын Гиясаддина,
        сына Таш-Тимура,
        сына Джансы,
        сына Тулек-Тимура,
        сына Кунчека,
        сына Саричи,
        сына Уран-Тимура,
        сына Тука-Тимура,
        сына Джучи,
        сына Чингиз-хана.

        Все линии крымских ханов восходят к Хаджи-Селим I Гирею. Его генеалогия:

        Хаджи-Селим I Гирей,
        сын Бахадур I Гирея,
        сына Селямета I Гирея,
        сына Девлет I Гирея,
        сына Мубарак-Гирея,
        сына Менгли I Гирея,
        сына Хаджи-Гирея (см. выше).

        После завоевания Россией Крымского ханства Гиреи распались на несколько ветвей:

        1. Русские Гиреи.

        Это - потомки последнего крымского хана Шахин-Гирея, они живут в России, в Ростове-на-Дону. Другая ветвь его потомков живет в Бурсе и Стамбуле.

        В России также остались жить потомки

        Александра Ивановича Крым-Гирея,
        сына Селима III Гирея,
        сына Фетиха II Гирея,
        сына Девлета II Гирея,
        сына Хаджи Селима I Гирея,
        сына Бахадур I Гирея,
        сына Селямета I Гирея,
        сына Девлет I Гирея,
        сына Мубарак-Гирея,
        сына Менгли I Гирея,
        сына Хаджи-Гирея (см. выше).

        Султан А.И. Крым-Гирей под влиянием шотланд¬ских миссионеров принял христианскую веру, затем уехал учиться в Петербург, и продолжил свое обучение в универ¬ситете Эдинбурга, где жил несколько лет. Там он женился на дочери богатого британца. Отец девушки был против этого брака, но ничего не смог сделать, кроме того, как лишить ее наследства. Вместе с мужем она покинула родной Эдинбург, чтобы поселиться с ним в Крыму. Ее звали Анна Яковлевна Крым-Гирей (урожденная Нейльсон). Потомки их проживают в Крыму.

        Другим потомком крымских ханов был Василий Дмитриевич Симов-Гирей, сын Дмитрия Симовхана Селим-Гирея. Василий учился в Норфолкском, Бернском, Цюрихском университетах, работал на сооружении Панамского канала, затем - в Египте, Германии, Центральной Америке, Японии. Он - кавалер орденов Станислава, Анны, Владимира. Как известный инженер, В.Д. Симов-Гирей был прикомандирован к Ставке главнокомандующего русской армией в первой мировой войне. За участие и выступление на митинге в г. Могилеве после Февральской революции он был отчислен из армии и отправлен на работу на Кольский полуостров. Принимал участие в строительстве Каширской электростанции и Беломор-канала. Приехал в Степняк (Казахстан) по срочному делу в командировку, так и прожил здесь 25 лет до своей смерти. К сожалению, потомков у него не осталось.

        Тамарин-Мерецкий Александр Александрович (1882 - 16.09.1938) Род. в д. Бахче-Эли Феодосийского уезда Таврической губ., Крымский татарин. До 1918 года имя и фамилия - Хан-Гирей. Окончил Лесной институт.

        Работал журналистом, военным корреспондентом популярных всероссийских газет "День", "Утро России".

        Поручик царской армии. Участник 1-й мировой войны. Служил на штабных должностях в "Дикой" горской кавалерийской дивизии.

        В 1917 - участник выступления генерала Л.Корнилова.
        С конца 1917 - в Красной гвардии, РККА. Участник гражданской войны.
        В 1920-23 - командир дивизии, командующий армией на Туркестанском фронте.
        В 1925 году уволен в запас по болезни. Проживал в Москве, получал пенсию, изредко публиковал очерки в различных газетах, в том числе в "Комсомолськой правде".
        8 апреля 1927 арестован ОГПУ по подозрению к причастности к военному заговору бывших офицеров царской армии. Приговорен к 3 годам лагерей. Сидил в Вишерском отделении СЛОНа (Соловецкого лагеря особого назначения). Заведовал лагерной оражереей, выращивал розы.
        3 сентября 1929 дело пересмотрено и заседанием Особого совещания (ОСО) при НКВД СССО (т.е. без суда) срок сокращен до 2,5 лет.
        Однако в том же 1929 дело опять пересмотрено ОСО и срок увеличен до 7 лет ИТЛ.
        3 октября 1932 освобожден, остался работать в тресте "Дальстой" НКВД СССР по контракут заведующим агробазы станции "Океанская" (близ Владивостока). Занимался разведением в парниках плодовых и овощных культур.
        22 марта 1935 постановлением ЦИК СССР за примерный труд судимость снята.
        С ноября 1935 - сотрудник (фактически - научный руководитель) агробазы в бухте Нагаево (около Магадана).
        С июня 1936 - первый управляющий Колымской опытной агростанции.
        В ноябре 1937 выехал в отпуск на "большую землю".
        В апреле 1938 уволен как не вышедший из отпуска на работу.
        До введения официальных воинских званий РККА (1935) - имел три ромба в петлицах, т.е. командир корпуса.
        Вывел морозоустойчивый сорт капусты "Гибрид Тамарина", гибридные сорта картофеля и роз.
        Арестован 10.05.1938. Приговорен ВКВС СССР 16.09.1938 по обв. в шпионаже и участии в к.-р. террористической организации. Расстрелян 16.09.1938. Реабилитирован 4.03.1958.
        Место захоронения: Коммунарка.

        Анна Ивановна Гирей (?-1827) Генеалогия неизвестна. Крестница генерала Раевского. Была подругой А.С. Пушкина, стала прообразом черкешенки из “Кавказского пленника”. Что касается поэмы «Бахчисарайский фонтан», которая была написана в Кишиневе, то следует согласиться, что прообразами главных героинь Марии Потоцкой и Заремы стали сестры Раевские и Анна Гирей. Елена - это Мария Потоцкая, нежная и печальная, в которую страстно влюблен хан Гирей. Эта гипотеза была высказана еще в 1923 году Д.С. Дарским [24].

        2. Много Гиреев эмигрировало в Турцию. Положение Гиреев в Турции было хорошо описано Смирновым: «Поколение Чингизидов, издавна водворившихся в турецких владениях, настолько было там многочисленно, что, кажется, не извелось и до настоящего времени. Но только с потерей политического значения род Гиреев принял совершенно иной характер в своем частном быту в качестве простых обывателей и подданных Отоманской империи. Татарские царевичи, расплодившись в Румелии, сделались чистой обузой для Порты».

        Если и сохранились потомки крымских ханов среди турков, то искать их надо в Румелии: среди турков в Болгарии и Европейской части Турции.

        Самым известным потомком Гиреев в Турции был Ахмед Тевфик-паша (1845-1936). Этот потомок династии крымских ханов Гиреев, последний османский садразам (глава султанского правительства), пользуясь огромным авторитетом у современников, с 1908 года четырежды возглавлял кабинет министров, причём трижды - в самые критические минуты существования государства - между 1918 и 1922 гг.

        3. Кавказские (в основном адыгские Гиреи)

        Основателем одной линии адыгских Гиреев был Ислам-Гирей, сын Азамат-Гирея, сына Хаджи-Селима I Гирея [25]. Он «покинул Крым из-за ссоры с правительницей Крыма», основатель адыгейской фамилии Хан-Гиреи. Согласно семейному преданию, переселился на Кавказ из Румелии, турецкой провинции на Балканах. Был он человеком храбрым и ума замечательного. Предвидя закат Крыма, он заключил с принявшими его бжедугскими князьями благоприятный для себя и своих потомков договор [26].

        Самый яркий представитель этого клана был

        Хан-Гирей (1808-1842),
        сын Магмет-Гирея,
        сына Аслан-Гирея,
        сына Сагат-Гирея,
        сына Ислам-Гирея.

        Хан-Гирей прожил сложную, но яркую и богатую событиями жизнь, оставив свои произведения. Он был первым и среди адыгов и среди русских, кто составил подробное, достоверное и увлекательно написанное описание быта, верований, обычного права и эпоса своего родного адыгейского народа. Первооткрыватель и исследователь Хан-Гирея в советское время М.О. Косвен в 1961 г. писал, что произведения Хан-Гирея и ныне остаются ценнейшими историческими и этнографическими источниками из всего, что об адыгах было написано за все дореволюционное время. Следует здесь отметить, что произведения Хан-Гирея вызвали определенный интерес известных русских и зарубежных кавказоведов, иностранной печати. Их использовал в своих работах русский кавказовед Вс. Миллер и ученый-англичанин Дж. Белл, а «Черкесские предания» публиковались на немецком языке.

        Брат Хан-Гирея – Адиль Гирей (1819-30.12.1876), известен как писатель и офицер.

        Другим известным представителем этого клана был

        Довлет Гирей (1876-1918),
        сын Селет-Гирея,
        сына Каплан Гирея,
        сына Аслан-Гирея,
        сына Сагат-Гирея,
        сына Ислам-Гирея.

        В пятилетнем возрасте Довлет был отвезен на воспитание в Египет к молочному брату отца. В Россию возвратился в четырнадцатилетнем возрасте. Менее чем через год был принят на учебу в Стамбульское кавалерийское училище, был выпущен корнетом. С разрешения Николая I дважды служил в Турции, оставаясь российским подданным. Довлет Гирей считается основателем адыгейского театра и первым сценаристом.

        Также к кавказским Гиреям относились:

        Султан Крым-Гирей Инатов (15.08.1843-?), сын Султан Инат-Гирея, известный Адыгский просветитель.

        Казы-Гирей Бахтыгиреевич (1807-13.04.1863), племянник проживавших в Закубанье генерал-лейтенанта Султана Менгли-Гирея и генерал-майора Султана Азамат-Гирея. В 1836 г. в первом и втором номерах журнала «Современник» выходившего в Санкт-Петербурге, были напечатаны очерки «Долина Ажитугай» и «Персидский анекдот» ранее неизвестного автора - Казы-Гирея. Тут же в примечании издателя, которым был А.С. Пушкин, говорилось: «Вот явление неожиданное в нашей литературе! Сын полудикого Кавказа становится в ряды наших писателей...». В.Г.Белинский, прочитав очерки, в восторге отозвался об авторе, что он «...владеет русским языком лучше многих почетных наших литераторов».

        Кылыч Гирей Шаханович (1880-17.1.1947), князь, один из руководителей горского националистического движения, генерал-майор белой армии (1918), сотрудничал с Германией во второй мировой войне, за что и был приговорен к смертной казни в СССР. Его потомки проживают в Адыгее. Его родной брат Байзет-Гирей был полным Георгиевским кавалером и погиб еще в 1918 году.

        Также к адыгским Гиреям по все видимости относились следующие Шан-Гиреи:

        Павел Петрович Шан-Гирей (1795-1864), глава семейства, штабс-капитан, протопип героя очерка Лермонтова "Кавказец". Его рассказы о Кавказской войне послужили материалом для ранних произведений поэта.

        Аким Павлович Шан-Гирей (1818-1883), сын Павла Шан-Гирея и Марии Акимовны, двоюродной тети Михаила Юрьевича Лермонтова.
        Султан Кадыр Гирей,
        сына Азамат Гирея,
        сына Селим Гирея (по другой версии Сагат Гирея),
        сына Селим Гирея,
        сына Девлет IV Гирея,
        сына Арслан-Гирея,
        сына Девлета II Гирея,
        сына Хаджи-Селима I Гирея.

        Известный деятель того времени князь Кадыр Гирей (1891-1953) был полковником в царской армии, ранен во время гражданской войны 05.01.1920. Эмигрировал с Кавказа в 1921 г. в Турцию, а оттуда в США, основал «Черкесско-Грузинское общество» в США.
        Его сын Чингиз Гирей (1921-) стал еще более знаменит, чем отец.
        Чингиз учился в престижном Йельском университете на одном курсе с будущим президентом Джорджем Бушем–старшим.
        В годы Второй мировой войны Чингиз служил в американской разведке. Чингиз Гирей был также писателем и поэтом, автором книги «В тени власти» ("The Shadow of Power"), ставшей в свое время бестселлером.
        Совсем молодым офицером Американской армии во время второй мировой войны ему пришлось играть ответственную роль - шефа русской секции Отдела связи между американскими и со¬ветскими командованиями в Австрии. После войны он участвовал в американской делегации на Мирную Конференцию в Москве в 1947 г.

        Азамат Гирей (14.08.1924-08.08.2001), младший сын Султан Кадыр Гирея. Объявил себя главой дома Гиреев. Был женат дважды: первая жена – Сильвия Оболенская(1931-1997). От этого брака (1957-1963) родились дочь Селима (род. 15.01.1960), сын Кадыр Девлет Гирей (род. 29.03.1961) и сын Адиль Сагат Гирей (род. 06.03.1964). Вторая жена – Федерика Анна Сигрист. От этого брака родился Каспиан Гирей (род. 09.03.1972).

        Селима вышла замуж в 1996 году за Дерека Годарда и родила в 1998 году дочь Алису Лейлу Годард.

        Кадыр Девлет Гирей женился в 1990 году на Саре Вентворт-Стэнли. У него сын Чингиз Карим Султан-Гирей (род. 1992) и дочь Тажа София (род. 1994).

        Адиль Сагат Гирей женился в 2001 году на Марии Саре Пето. В 2002 году у него родился сын Темуджин Сердж Гирей.

        Кадыр Девлет Гирей и Адиль Сагат Гирей профессиональные музыканты, игравшие в группе Funkapolitan. Адиль Сагат Гирей композитор, пишет саундтреки и мелодии в различных жанрах. (www. sagatguirey.com)

        После смерти Азамат Гирея на Багамах, главой дома Гиреев стал Джеззар Раджи Памир Гирей. Он окончил Оксфорд. 28 июля 1993 года приезжал на курултай крымских татар в Симферополь и выступал перед ними как принц дома Гиреев. Джеззар Гирей является владельцем Giray Design Company. На мои запросы с просьбой предоставить свою генеалогию и сдать (анонимно) ДНК-тест, ответа не последовало.


        Ногайские чингизиды

        1. Джанибековы.

        Очень многим было известно, что родословная Лилии Мунировны Джанибековой, первой жены космонавта Владимира Александровича Джанибекова, идёт от хана Золотой Орды Джанибека, сына хана Узбека. Впоследствии, в ХIХ веке, потомки ханов стали просвещенцами, основателями ногайской письменности и литературы. Мунир Джанибеков (отец Лилии Мунировны), будучи отцом двух дочерей, оказался последним мужчиной в этой династии. На совете родителей молодоженов стороны пришли к соглашению, чтобы Владимир Александрович, которого Мунир-ага считал своим сыном, взял фамилию жены и тем самым продолжил род Джанибековых.

        Мы склоняемся к версии, что эта фамилия происходила не Джанибека, хана Золотой Орды, а от казахского хана Джанибека. В устной литературе кочевников их часто путают. Основанием для такой позиции является известие об откочевке Ахмед-Гирея на Кубань.

        Ахмед-Гирей,
        сын Хак-назар-хана,
        сына Касым-хана,
        сына Джанибек-хана.

        Ахмед-Гирей, казахский чингизид, правивший среди башкиров, и откочевавший вместе с ногайцами из Башкирии вскоре после падения Казани и раскола Ногайской Орды.

        Среди Ногайской Орды проживали чингизиды трех линий, восходивших к Джучи: астраханские, казахские чингизиды (потомки 13-го сына Джучи) и шибаниды (потомки пятого сына Джучи). Их потомки гипотетически могут существовать среди современных ногайцев.


        Тарковские шаухалы

        В литературе нет однозначного ответа, происходят ли кумыкские шаухалы от чингизидов. Ханмурзаев И.И. и Идрисов Ю.М. считают, что шаухалы имеют общих предков с крымскими Гиреями [27], Алиев К.М. имеет другую точку зрения. Возможно, сопоставление гаплотипов кумыкских шаухалов и казахских торе поможет разрешить эту проблему. Следует также учесть, что потомки Тарковских шаухалов очень многочисленны на Кавказе.

        К потомкам шаухалов на Кавказе относятся аварские ханы, аргуанийские и андийские беки, гонадинские, гоцатлинские, телетлинские князья, князья Турловы и происходящие из них чеченские княжеские фамилии Айдемировы и Хасбулатовы, Шамхаловы (андийские), карачаевские князья Крым-шаухаловы, гидатлинские шаухалы, абхазские князья Ачба, некоторые ингушские тейпы, кумыкские фамилии Тарковские, Буйнакские, Шамхаловы, Мехти-Шамхаловы, Бек-мурзаевы, различные чанки (потомки шаухалов от наложниц), князья Буйнакские, Гиллинские и Торкалинские беки, князья Алыпкачевы, Капчугайские беки (Казаналиповы), Губденские и Кадарские беки, Бекмурзаевы-Кубанские (обрусевшая ветвь), Бамматулинские беки, кумыкские княжеские фамилии: Айдемировы, Темировы, Казаналиповы, Муртузали-Аджиевы (из этой фамилии происходит Мурат Аджи), Уцмиевы, Каплановы, Алибековы, Эльдаровы, Арсланбековы, Хамзины (Хамзаевы, Алишевы), мехтулинские ханы, Кази-кумукские князья и польская ветвь Тарковских, откуда произошли Арсений и Андрей Тарковские [28].




        Киргизские чингизиды

        Процитируем письмо одного киргиза, чей дед гипотетически относился к чингизидам: «Я до сих пор внимательно изучал старые книги о санжыра. И наткнулся на то что есть две версии по поводу происхождения колпоч. Одна версия говорит что Эр Эшим (казахский хан Ишим, сын Шигая, сына Джадика, сына Джанибек-хана) женился на наложнице Турсунхана (шибанид, потомок пятого сына Джучи), и дети, появившиеся от этого брака, относятся к племени колпоч. Другая версия говорит, в подтверждение чего я слышал когда то из уст знающих аксакалов Таласа, что во время набега на Турсунхана, одному из батыров рода саруу Тонтерту досталась беременная наложница Турсунхана. Она родила сына названного Жанчакты, и потомки его сегодня составляют племя колпоч. Мой тайата (отец мамы) представитель племени колпоч, его родословная представлена следующим образом». Дальше шла родословная.

        По гаплогруппе он относится к С3 (ID HGZPP), к той же подгруппе что и казахские чингизиды с RecLOH в DYS 448, но, по всей видимости, представитель рода Колпоч имеет предка с казахскими чингизидами раньше Чингиз-хана.


        Казахские чингизиды

        На сегодняшний день казахские чингизиды по численности вполне равны монгольским чингизидам и превосходят по численности чингизидов в других этносах. В силу того, что русскоязычные читатели могут познакомиться с биографиями казахских торе по книгам Ерофеевой И.В. и другим источникам, мы не будем сильно расписывать этот клан.

        Большинство казахских чингизидов происходят от
        хана Джанибека,
        сына Барак-хана,
        сына Куйурчука,
        сына Урус-хана,
        сына Бадыка,
        сына Тимур-ходжи,
        сына Бакубуки,
        сына Ачика,
        сына Уран-Тимура,
        сына Тука-Тимура,
        сына Джучи,
        сына Чингиз-хана.

        1. Урусханиды

        У Джанибека было 9 детей, из них потомки троих детей живут в Казахстане.

        1.1. Потомки Джадика. Это – самая многочиленная группа. Сюда входят потомки Тауке-хана, Барак-хана, Кушик-хана, Каип-хана, Абылайхана, Султанбета, Бабак-султана, Карабая и т.д. Большая часть казахских чингизидов происходят из этой династийной группы.
        К этому клану (кроме казахских ханов) относятся Шокан Валиханов, Алихан Букейханов, Тезек-торе, Рустем Тентек-торе, Сыздык Кенесарин, Макы, Шотаман, Султангази, Едиге Валихановы, Ермухан Бекмаханов, Нурлан Амрекулов, Елизавета Садвакасова, Срым Букейханов, Мажит Бураханов, Бахытжан, Ерулан, Сержан Канапьяновы, Ахмет и Салимгирей Жанторины, Ахмедказы Чутаев, Мухтар Джакишев и т.д.

        Зарегистрированный потомок этого клана в базе www.ysearch.org имеет User ID 9245Z. Его близкий родственник зарегистрирован под User ID CQYS8.
        Они оба являются потомками султана Барака.

        1.2. Потомки Усека представляют основную линию от Абулхаир-хана, хотя есть много родственных, но малочисленных линий. Отсюда пошла единственная семья казахов, удостоенная княжеского достоинства в России – это дети хана Джангира, именовавшие себя Чингис. 3 сынам хана Джангира были жалованными князьями Российской Империи: Все они имели фамилию Чингис и родовой герб. Первым князем Чингис был Сахиб-Гирей, который был пожалован этим титулом 25.06.1847. Вторым князем Чингис был Ибрагим-Гирей, который был пожалован этим титулом 23.02.1853. Третьим князем Чингис был Ахмед-Гирей, который был пожалован этим титулом 30.04.1870. Всего в Российской империи за все время существования было всего 33 жалованных князей.
        Из сыновей хана Жангира наиболее известен Губайдулла, также выпускник столичного привилегированного Пажеского корпуса. Он стал первым казахом - полным генералом рода войск.
        Зарегистрированный потомок этого клана в базе www.ysearch.org имеет User ID BK4A3. Он является прямым потомком хана Абулхаира. Потомками этого клана являются такие люди как Даулеткерей, Майя Шигаева, Диас, Габдолхаким, Хазихан, Науша Букейхановы, Марат, Рустем, Жиханшах, Альмухаммед и Тулеу Сейдалины, Камбар Медетов, Санджар Асфандеяров, Бахытжан Каратаев, Амантай Альмукамбет

        1.3. Потомки Касыма. Упомянуты только у Шотамана Валиханова, хотя нигде в других исторических источниках – эта группа не зафиксирована. Раньше у меня были серьезные вопросы по этой группе, пока я не увидел шежере рода Шекты (http://www.elim.tustyle.com/files_kishi/alimyly/shekti.rar), где эта ветвь прописана как часть рода шекты. При этом Мадели, один из предков ветви, назван жиеном Кунбиби-Кубы (дед по материнской линии). Вероятно, эта версия основана на генеалогических преданиях рода шекты. Поэтому мы теперь отнесем эту ветвь к гипотетическим чингизидам. Для проверки версии следует представителям этой тайпы пройти ДНК-анализ, который можно сравнить с ДНК-анализами торе. Мы оплатили результаты анализа представителя этого клана.

        2. Шибаниды.

        Вторая группа казахских Чингизидов вышла из Хорезмских Шейбанидов, бежавших в казахские степи. Это – потомки Хаджи-Мухаммеда, хивинского хана.

        Его генеалогия:

        Хаджи-Мухаммед,
        сын Акатай-хана,
        сына Аминек-хана,
        сына Ядигер-хана,
        сына Тимур-шейха,
        сына Тимур-ходжи,
        сына Араб-шаха,
        сына Пулада,
        сына Менгу-Тимура,
        сына Бадакула,
        сына Джучи-Буки,
        сына Бахадура,
        сына Шибана,
        сына Джучи,
        сына Чингиз-хана.

        Потомком Хаджи-Мухаммеда был Джочи, у которого было два сына – Шах-Нияз (отец Ильбарс-хана) и Муса-хан (отец Шах-Тимура). Дети кузенов переселились по отдельности в Казахстан. После смерти Шах-Тимур-хана в 1737 году его вдова с детьми переселилась к отцу Булхаир-султану, брату Абулхаир-хана. Сейчас эти потомки Шибанидов проживают в Казахстане.

        3. Жадигер-торе:

        Зарегистрированный потомок этого клана в базе www.ysearch.org имеет User ID WJKAQ. Если с предыдущими кланами история ясна, то про жадигер-торе можно пока только строить догадки. Доподлинно неизвестно происхождение клана. В основном этот клан проживает в Кзыл-Ординской области.

        Нами было выдвинуто две полноправные версии происхождения клана:

        1. Жадигер-торе – потомки хорезмских шибанидов (потомки Ядигера)

        2. Жадигер-торе – потомки казахских торе, восходящие к общеказахскому хану Джанибеку. Скорее всего, они происходят из группы потомков Джадика.

        Шежере клана обрывается на Жадигер-торе. По устной информации одного из потомков клана, отцом Жадигера был или Джанибек, или Абулхаир. В связи с этим мы выдвинули версию, что предком клана был Джанибек, зять хана Абулхаира. Генеалогия этого Джанибека неизвестна. Он с равным успехом может быть и потомком Джанибек-хана, и потомком Хорезмских Шибанидов.
        Думаю, данные ДНК-анализа при определенной репрезентативности и массовости смогут нам помочь определить место жадигер-торе среди чингизидов. Есть два варианта по генеалогическим раскладам:
        1. Общий предок Джучи (1182-1227) или
        2. Общий предок хан Джанибек (род. до 1428 – умер после 1470).

        4. Среди казахских найманов один из кланов имеет легенду о том, что их предком по мужской линии был шибанид. У Каракерея был сын Байторе, у того сын Байыс.
        Дочь Байыса Макта Апай вышла замуж за Токтар-кожу, сына Сайбек-хана и родила от него двух сыновей - Ерджигита и Байджигита. Epджигит уходит с отцом в Туркестан, Байджигит остается здесь и становиться предком этого клана. К этому клану принадлежал Кабанбай батыр (Ерасыл, сын Ходжагула, сына *****а, сына Байджигита). На данный момент мы собираемся взять пробы у одного из представителей этого клана.


        Гаплогруппа С3

        Три ветви казахских чингизидов относятся к гаплогруппе С3 и имеют характерную мутацию: RecLOH в DYS 448. Обнуление аллели, скорее всего, произошло еще до Чингиз-хана, так как такую же метку имеют несколько поляков, киргизов, и казах из рода ысты.

        Гаплотип потомка Барака (в формате FTDNA):

        14 24 15 10 12 14 11 13 12 13 11 29 16 8 8 11 12 30 14 0 28 11 12 12 18

        Гаплотип потомка Абулхаира:

        14 24 15 11 12 14 11 13 12 13 11 29 16 8 8 11 12 30 14 0 28 11 12 12 17

        Отличие двух чингизидов на двух маркерах из 25 (выделено).

        Формально это различие составляет примерно 600 лет от общего предка, но погрешность такого расчета по двум гаплотипам составляет как минимум плюс-минус 300-400 лет. По генеалогическим данным их общий предок хан Джанибек (род. до 1428 – умер после 1470), что не противоречит данным ДНК-анализа.

        Потомки Барака и Абулхаира сделали анализ 67 маркеров, в отличие от Жадигер-торе, который пока ограничился 25 маркерами.

        Гаплотип жадигер-торе:

        14 24 15 10 12 14 11 13 12 13 11 29 15 8 8 11 12 29 14 0 29 11 12 12 18

        Отличие от потомка Барака на трех маркерах из 25 (отмечено), отличие от потомка Абулхаира на 5 маркерах из 25.

        5 мутаций на трех 25-маркерных гаплотипах показывают, что общий предок всех троих жил 925 лет назад, то есть в конце 1000-х годов, с погрешностью примерно 100-200 лет. Это не противоречит тому, что их общим предком является действительно Чингиз-хан или Джучи. Но пока из-за малого количества данных, мы не можем со 100%-уверенностью говорить об этом, требуется увеличить количество анализов, хотя бы до 10 человек из различных линий.

        Очень интересны с этой точки зрения сравнение ДНК современных чингизидов с хуннскими захоронениями в Монголии (третий сектор захоронения). На 12 маркерах гаплотип из захоронений выглядит так:

        13 24 15 10 12 15 х х х х 11 29

        Х означает, что значение этого маркера неизвестно.

        Отличия этого гаплотипа от чингизидов на двух маркерах из восьми (средняя скорость мутации 0.00194 на маркер на поколение) указывает на их общего предка, жившего примерно 1850 лет назад, то есть вторая половина 2-го века нашей эры, плюс минус как минимум столетие. Датировка захоронения – 3-й век нашей эры (время захоронения людей из 3-его сектора) свидетельствует о том, что, скорее всего, там захоронены сяньбийцы, возможно сам Таншихай и его семья.

        Исходя из всего вышесказанного, мы можем утверждать, что нам стал известен гаплотип казахского хана Джанибека:

        14 24 15 10 12 14 11 13 12 13 11 29 16 8 8 11 12 30 14 0 28 11 12 12 18

        Возможны некие вариации, но в целом гаплотип был таким.

        Мы в целом обрисовали генеалогическую картину чингизидов. Теперь наша задача – собрать генетическую картину чингизидов и путем наложения друг на друга ответить на некоторые вопросы, на которые традиционными историческими методами (критическое источниковедение и др.) ответить было практически невозможно, например, на вопрос, являлся ли Джучи генетическим сыном Чингиз-хану, или же проверка версий о происхождении какого-либо рода от Джучи и Чингиз-хана. Но рассмотрение этого вопроса будет возможно только при сборе ДНК-образцов у большинства известным нам чингизидов и потомков его братьев.


        Литература


        1. Сабитов Ж.М. «Генеалогия Торе». Алматы. 2008. стр. 83-90.

        2. Сабитов Ж.М. «Генеалогия Торе» Алматы. 2008. стр. 266-268.

        3. http://www.bumbinorn.ru/2006/02/03/khabutu_khasar.html

        4. Сабитов Ж.М. «Генеалогия Торе» Алматы. 2008. стр. 274-278

        5. История Казахстана в персидских источниках. Том 3. Алматы. 2006. стр. 196.

        6. История Казахстана с древнейших времен до наших дней в пяти томах. Т.3.
        Алматы. 2000. стр. 279-280

        7. «The history of India. As Told By Its Own Historians». Edited by Prof. John Dowson. 1956 Calcutta. «The history of the Arghuns and Tarkhans of Sind». Siddiqi, Mahmudul Hasan, and Mīr Muḥammad Maqṣūm. Hyderabad, Pakistan: Institute of Sindhology, University of Sind, 1972.

        8. Гайворонский О. «Повелители двух материков». Киев. 2007. стр. 22

        9. Зайцев И.В. «Между Москвой и Стамбулом» М. 2004. стр.93, Сабитов Ж.М. «Генеалогия Торе» Алматы. 2008. стр. 57

        10. Думин С.В. «Татарские царевичи в Литве». http://www.misharlar.ru/tttzliet.html

        11. Dziadulewicz Stanisław «Herbarz rodzin tatarskich w Polsce» Wilno. 1929.

        12. Гришин Я.Я. «Польско-литовские татары: взгляд через века» Казань. 2000., Гришин Я.Я. «Польско-литовские татары: наследники Золотой Орды» Казань. 1995.

        13. Neagu Djuvara «Iarasi despre Negru Voda si "Descalecatoare"» http://www.itcnet.ro/history/archive/mi200...rrent8/mi53.htm

        14. Гарднер Л. Царства Властителей Колец: По ту сторону сумеречного мира / Лоренс Гарднер. - Пер. с англ. К. Савельева. - М.: ФАИР-ПРЕСС, 2003. стр. 334.

        15. Сборник материалов, относящихся к истории Зо¬лотой Орды Т. 2: Извлече¬ния из персидских сочинений/Сост. В. Г. Тизен¬гаузен, обработка А.А.Ромаскевича и С.Л.Воли¬на., М, Л 1941. стр. 141

        16. Сабитов Ж.М. «Генеалогия Торе» Алматы. 2008. стр. 35-38.

        17. Сабитов Ж.М. «Генеалогия Торе» Алматы. 2008. стр. 80

        18. http://www.rostmuseum.ru/publication/histo...1/kuzmin01.html

        19. Сабитов Ж.М. «Генеалогия Торе» Алматы. 2008. стр. 49.

        20. Статья выйдет в сборнике: Всероссийской научной конференции, проходившей 20 мая 2008 года «Политическая и социально-экономическая история средневековых тюрко-татарских государств (XV – третья четверть XVIII в.)».

        21. Сабитов Ж.М. «Генеалогия Торе» Алматы. 2008. стр. 80-81.

        22. Сабитов Ж.М. «Генеалогия Торе» Алматы. 2008. стр. 98.

        23. Сабитов Ж.М. «Генеалогия Торе» Алматы. 2008. стр. 113.

        24. А.Люсый. "Ангел утешенья" // "Октябрь, 1997, №6, с.171-174/

        25. Сабитов Ж.М. «Генеалогия Торе» Алматы. 2008. стр. 90-91.

        26. Вершигора А.Д. «Родословная адыгского просветителя султана Хан Гирея. //Генеалогия Северного Кавказа. №2 стр. 14-28

        27. Ханмурзаев И.И., Идрисов Ю.М. Проблема образования средневекового кумыкского государства Шаухальство в контексте политического наследия Улуса Джучи на Северном Кавказе // Золотоордынская цивилизация. Сборник статей. Выпуск 1. – Казань: 2008. Стр. 127-128

        28. Алиев К.М. «Шаухалы Тарковские» Махачкала. 2008.

        29. Подробную генеалогию казахских чингизидов можно увидеть в книге Сабитов Ж.М. «Генеалогия Торе» Алматы. 2008. стр. 139-266.
        13-25-X-10-X-X-11-14-10-10-11-16

        8. Гаплогруппа предка старкластера – С(хС3с), то есть гаплогруппа С, в которую не входит подгруппа С3с.
        --------------------
        ДНК-паспорт:
        R1a1.
        13 25 17 10 11 14 15 12 10 13 11 31

        Замечательный труд, уважаемый!
        Но осталось неясным, почему вы адмирала Кондратьева исключтили из списка чингизидов, хотя у него вроде тот же маркер (в гаплотип я не вдавался, думаю вы сами его посмотрите).
        Есть еще интересная информация:
        В марте 1606 Лже-Дмитрий I направил наставнику монастыря Св. Кирилла в Белозерском письмо, содержащее приказ заключить Симеона Бекбулатовича в качестве монаха тем же образом, как и его тестя князя Мстиславского. В исполнение этого приказа прежний царь Симеон стал «монахом Степаном». В тоже время его жена царица Анастасия была принуждена стать монахиней. Она умерла в 1607 и была похоронена под именем «сестры Александры». Лже-Дмитрий I был склонен удалить Симеона Бекбулатовича по нескольким причинам. Главной из них было то, что Симеон продолжал рассматриваться как кандидат на трон России.

        После убийства Дмитрия и победы князей Шуйских новый царь Василий Шуйский (Василий IV) приказал наставнику монастыря Св. Кирилла в Белозерском привести к его послу Федору Суконеву монаха Степана, который «был прежним царем Симеоном Бекбулатовичем». Последний был переведен в Соловецкий монастырь на крайнем Севере, где он прожил шесть лет в исключительной нищете. После восшествия на трон Михаила Романова в 1613 царь Симеон, по-видимому, получил разрешение покинуть монастырь Святого Кирилла, поскольку он умер уже в Москве в январе 1616 и был похоронен около своей жены в монастыре Св. Симеона. Он имел трех сыновей, Федора, Дмитрия и Ивана, и трех дочерей, Евдокию, Марию и Анастасию. Они, по-видимому, умерли насильственной смертью, поскольку известно, что Симеон Бекбулатович пережил всех своих детей.

        Потомки Петра Казанского:

        Кудай-кул (Петр Казанский) (?-1523),
        сын Ибрагима,
        сына Махмутека,
        сына Улуг-Мухаммеда.

        Царевич Кудай-кул был захвачен в плен в 1487 году русскими, взявшими Казань. Он вырос в русском плену, впоследствии был доставлен из ссылки в Москву и освобожден из-под ареста. 21 декабря 1505 года его торжественно крестили на Москве-реке с именем царевича Петра Ибрагимовича. Через неделю, 28 декабря, царевич Пётр дал запись великому князю Василию III в том, что он будет служить ему верно, а еще через две недели, 15 января 1506 года молодой царь отдал Петру в жёны свою 14-летнюю сестру Евдокию (младшую дочь великого князя Ивана III от его второй жены Софьи Палеолог). Евдокия и Пётр были обвенчаны в Успенском соборе московского Кремля архимандритом Спасского монастыря Афанасием.

        Для Василия III царевич Петр был не просто родственник. Он стал его ближайшим сподвижником, верным и надёжным другом. Более того, московский великий князь видел в нём своего преемника. Бездетный Василий III перед походом на Псков в 1509 году написал завещание, согласно которому в случае его гибели престол должен перейти к царевичу Петру. Покидая на время Москву, великий князь всё чаще доверял управление и защиту столицы своему зятю.

        У Петра--Худай-Кула было две дочери, обе по имени Анастасии. Старшая из них была замужем за кн. Федором Михайловичем Мстиславским, младшая - за кн. Василием Васильевичем Шуйским. У А. П. Мстиславской был сын Иван Федорович, дочь которого Анастасия Ивановна вышла замуж за бывшего Касимовского хана Саин-Булата, крестившегося с именем Симеона Бекбулатовича. У А. П. Шуйской была дочь Марфа Васильевна, бывшая замужем за кн. Дмитрием Ивановичем Бельским.

        Дело в том, что родственники потомков князя мстиславского мне известны, правда прямой связи вроде как нет, но происходят Пожариские от него. И в Москве еще живет один потомок по даной линии

        НО МЫ ИЩЕМ НАШИ КОРНИ.

        0
      • гыгы999
        3 ноября 2012  

        ЧИНГИЗХАНА возвеличивают западные историки, называя его "Потрясателем вселенной".

        Монголы конечно им гордятся, но если посмотреть территории Восточной и Западной тюркских каганатов, то получится практически то же самое, что завоевал он, не считая Русь и Иран (но их завоевали после его смерти, его внуки). Тэмучин взрос во времена когда про это может быть рассказывали мудрые старики, т.е. он знал, что можно пройти от моря до моря, но для этого надо подчинить себе разрозненные татарские племена. Что он и сделал, дав племени новое название и новый импульс, а впоследствии прошел практически по проторенной за тысячи лет до него и несколько раз в истории степи, этими предками были племена легендарных кочевников САКОВ.

        0
        • Могул
          3 ноября 2012  

          Гыгы999

          Казахский исследователь противоречит самому себе. Утвеждает, потомков ЧХ должно быть мало, и, тут же начинает показывать как их много! Да много их, много, и среди европейцев и русских много, оказывается. А почему не исследованы якуты, или итак понятно, что якуты и есть Саха Монголы. Конечно никто, я думаю, на прямое родство с самим Чыҥыс ханом не претендует. Или есть такие? Но на то, что мы и есть БОРДОНЦЫ (БОРДЖИГИНЫ), и что мы ЙЕХА МОГАЛЫ мы можем претендовать с уверенностью!
          И попутно, одно замечание относительно исследования казахского ученого. Оказывается, потомки Кучума и продолжали править то, и после так называемого завоевания Сибири Ермаком.

          0
      • гыгы999
        3 ноября 2012  

        Геном Чингисхана.

        Скрытый текст

        Геном Чингисхана полностью расшифрован ← Очевидное - невероятное
        Китайские ученые из Сельскохозяйственного университета Внутренней Монголии заявили о расшифровке генома Чингисхана. Теперь, как они утверждают, им удастся проследить за тем, как расселялись потомки великого завоевателя по планете.

        Найти и восстановить ДНК самого великого полководца китайцам по объективным причинам не удалось — захоронение Чингисхана до сих пор не найдено. Для своих научных изысканий исследователи взяли образец ДНК у его прямого потомка в 34-м поколении, живущего сейчас. Ученые уверены на 100 процентов, что мужчина, чей геном они секвенировали, является самым настоящим чингизидом, поскольку происходит из рода, который издавна обосновался в китайской провинции Внутренняя Монголия и никогда не смешивался с другими народностями.

        Ученые недаром занимались исследованием именно мужского генома. Из-за особенностей наследования проследить родство с Чингисханом через 34 поколения можно только по Y-хромосоме. Она, как рассказала «Итогам» ведущий научный сотрудник Института общей генетики имени Н. И. Вавилова кандидат биологических наук Светлана Боринская, «передается от отца к сыну почти без изменений. От остального генома Чингисхана у его потомков сохранилась лишь небольшая часть, так как все прочие прапрапрадедушки и бабушки за 34 поколения внесли равные вклады в ядерный набор генов. Хромосомы перемешиваются, рекомбинируют при образовании зародышевых клеток, поэтому унаследовать их неизменными более чем через 30 поколений невозможно».

        Как заявил руководитель исследований, директор университета по науке и технологиям Чжоу Хуаньминь, это достижение носит для ученых принципиальный характер. Далее они планируют расшифровать еще 199 ДНК монголов и создать генетическую базу данных этого народа. Исследования помогут установить специфические черты, присущие только монголам, и отследить миграцию народа, некогда наводившего ужас на всю Евразию. Но почему китайцы так настойчиво стремятся расшифровать геном именно Чингисхана?

        Несомненно, что имя великого завоевателя давно стало брендом, под который легко выбить деньги на исследования. Однако, кроме того, принято считать, что среди современных монголов потомков именно Чингисхана несравненно больше, чем кого-либо другого. Столько потомков за 1000 лет ни у кого больше не имелось ни в Монголии, ни где-либо еще. Как рассказывают этнографы, когда они бывают в Монголии, о половине мужчин они сами или их друзья говорят, что они по прямой линии происходят от великого завоевателя. Повод для таких утверждений действительно имеется. Став правителями, ханы резко повышали свой репродуктивный статус. «Иметь правителя из чингизидов было престижно, так что многие из них могли оставить кучу потомков не из-за генетических особенностей, а по социальным причинам», — утверждает Светлана Боринская. Впрочем, есть и другое мнение. Согласно данным сотрудника департамента биохимии Оксфордского университета Татьяны Зерьял и ее коллег, 8 процентов мужчин на территории бывшей Монгольской империи унаследовали свою Y-хромосому от общего предка, жившего примерно 1000 лет назад. Никакого другого исторического претендента на роль этого предка, кроме Чингисхана, просто не нашли.

        С учетом того, что сегодня, по разным оценкам, на территории Китая, Монголии и России проживает от 10 до 16 миллионов этнических монголов, потомков Чингисхана среди них должно быть чуть более миллиона. Но, как отмечает Светлана Боринская, во Внутренней Монголии частота Y-хромосомы завоевателя доходит до 25 процентов, а значит, носить часть генома великого завоевателя может в разы большее количество людей.

        Впрочем, историк, научный сотрудник Евразийского национального университета (Астана) Жаксылык Сабитов напрочь опровергает эти подсчеты. По его словам, после изгнания монголов из Китая в 1368 году в Монголии начались междоусобные войны. Тогда-то большинство монгольских чингизидов погибли. Как рассказывает историк, приходившие к власти ханы вырезали своих родственников как потенциальных конкурентов за власть. В результате из прямых потомков Чингисхана остался только один Даян-хан, который был еще совсем ребенком. Это привело к тому, что сегодня потомками Чингисхана себя по полному праву могут считать лишь примерно 20 тысяч человек (цифра оценочная и неточная). Из них около 10 тысяч проживают в Китае и Монголии (потомки Даян-хана), а вторая половина в Казахстане (потомки Джучи, сына Чингисхана). Жаксылык Сабитов объясняет результаты работы коллектива Татьяны Зерьял тем, что исследованные люди были не потомками Чингисхана, а могли иметь с ним одного общего предка. «Скорее всего, так называемый ген Чингисхана мог принадлежать Бодончару, предку многих монгольских племен», предполагает историк. И уже его потомки, в том числе и император, расселились по территории Евразии. Эту версию, кстати, подтверждают участники проекта «Генография» из лаборатории популяционной генетики человека Федерального государственного бюджетного учреждения «Медико-генетический научный центр» РАМН, которые также нашли следы «гена Чингисхана».

        Изучая пути расселения людей, носящих гаплогруппу С3 Y-хромосомы, приписываемую Чингисхану, специалисты проекта «Генография» исследовали образцы ДНК у 486 популяций по всему миру. В итоге они пришли к выводу, что большинство носителей этого генетического варианта, являющихся возможными потомками или далекими родственниками завоевателя, сейчас обитают в Восточной Сибири и Центральной Азии. «В Европе этот вариант практически не встречается, лишь изредка у жителей Поволжья», рассказывает кандидат биологических наук, сотрудник Центра Олег Балановский. Максимальная частота встречаемых носителей данной гаплогруппы в некоторых районах достигает 91 процента при том, что среднее число составляет всего 8 процентов. В общем же люди, несущие генетический вариант С3, заселяют практически треть всего земного шара.Для жителей современной России данные о расселении потомков великого монгола также являются важными. Высказывались, например, предположения, что склонность к «зеленому змию» чуть ли не у половины российских мужчин связана именно с геном, привнесенным монгольскими завоевателями на Русь. Такой ген якобы приводит к более быстрому окислению спирта в печени и превращению его в токсичный альдегид. Из-за этого многие китайцы и монголы не могут выпить «европейское» количество алкоголя — у них слишком быстро наступает отравление альдегидом. Но генетики опровергают этот факт.

        Светлана Боринская полагает, что монгольское завоевание почти не оставило следов в генах русских. А частота того самого азиатского варианта гена алкогольдегидрогеназы, контролирующего окисление спирта в печени, составляет у нас пять процентов. Ученые проанализировали ДНК более тысячи русских в разных регионах от Костромы до Чукотки и доказали, что по генам, контролирующим окисление спирта, русские ничем не отличаются от других групп европейского происхождения. В России, как утверждают ученые, гораздо важнее социальные, а не генетические причины алкоголизма — так же, как и в Европе.

        Получается, что генетики опровергли старую присказку о том, что будет, если «поскрести любого русского». В Центральной России потомков монголов практически нет. Подтверждено генами.

        * * *

        Дмитрий Мадуров, историк, кандидат искусствоведения, автор книг по истории Золотой Орды:

        — Считается, что сейчас на свете живет около двух миллионов потомков Чингисхана. У него было много жен и наложниц, которые нарожали ему кучу детей. Потом его сыновья и внуки правили на территории Великой Монгольской империи. У них тоже были жены, рожавшие детей. Так ген завоевателя и множился, но все же монголов, в том числе и потомков Чингисхана, в свое время было гораздо больше, чем сейчас. Их исчезновению, во-первых, способствовали манчжуры, которые проводили политику обращения монголов в ламаистские монахи. Те, кто был обращен, естественно, не оставили после себя потомства. Во-вторых, очень много монголов, которые захватили почти половину территории Китая, вырезали сами же китайцы во время «восстания красных повязок», начавшегося в 1351 году.

        Юрий Сиволап, доктор медицинских наук, профессор Первого московского медицинского университета им. И. М. Сеченова:

        — Сомневаюсь, что современные жители Евразии в большинстве своем могут иметь родственные связи с Чингисханом. И уж точно не является доказательством склонность к алкоголю. У многих азиатских народов другие ферментативные профили, нежели у европейцев, и поэтому у жителей Востока плохая переносимость алкоголя. Насколько здесь виноват Чингисхан и его гены, сложно определить. Нельзя сказать, что именно у монголов такая проблема с алкоголем. Но однозначно: чем дальше на восток в сторону Юго-Восточной Азии, тем хуже с ферментами. То же самое и у народов Крайнего Севера, где в том числе много монголоидов.

        Источник: itogi.ru


        image

        На карте проекта «Генография» обозначены территории, заселенные людьми с гаплогруппой C3 Y-хромосомы, считающейся «геном Чингисхана». Разными Цветами показана частота встречаемости генов в долях. Максимальная частота — 0,91. Она соответствует 91 проценту популяции (фиолетовый цвет). Средняя частота — 0,08 (8 процентов)
        Якутия вся фиолетовая)))

        0
        • Оidоv
          3 ноября 2012  

          Не может быть потомков Чингизидов в Якутии . Они стали врагами Урянхай и Ураанхай .

          Более аргументированное объяснение , не пропускают .

          0
      • гыгы999
        3 ноября 2012  

        Это говорит об обратном Монголы потомки САХА!

        0
      • гыгы999
        3 ноября 2012  

        Бурятский ученый потомок кельтов. О геноме Чингизхана.

        Скрытый текст
        Известный ученый, доктор философских наук Николай Абаев, работающий ныне в Туве опубликовал небольшой очерк о своих генах

        - Обнаружив в своем генетическом древе, любезно предоставленном мне алма-атинской молекулярно-генетической лабораторией, генную группу «Rib», типичными представителями которой являются потомки кельтов (ирландцы, шотландцы и другие западные европейцы), а также баски и башкиры, я сначала очень удивился, поскольку ни одного выходца из Западной Европы среди моих предков не было – пишет Абаев - но вполне достоверно имелись сибирские скифы, уйгуры, урянхайцы, восточные хакасы и «хребетные монголы» Чингисхана.

        Однако, проанализировав вероятные генетические связи своих предков, особенно их происхождение от общей прародительницы Алан-Хо («Мать-Оленуха»), само имя которой указывает на этногенетические связи с «царскими» скифами, первым легендарным царем которых был «царь-солнце» Колоксай, а он является предком родов Кол и Кулар, я пришел к выводу, что появление кельтских генов в моих собственных генах вполне закономерно. Как, впрочем, и признаки «арийских» генов у самого Чингисхана, что тоже является достаточно известным фактом (светлые волосы, белая кожа, зеленые глаза и т. д.).

        Интерес представляет в связи с кельто-сибирскими параллелями также то, что плотность распространения этой генной группы примерно совпадает с районами строительства мегалитов в Западной Европе. Это наводит на мысль о подозрительной связи повышенной конопатости хакасов и их древнейших мегалитов с особой густотой веснушек у потомков кельтов, а также финно-угорского населения Поволжья, Приуралья и Западной Сибири.

        Предполагаемым генотипом самого Чингисхана считается группа «С», подгруппа «С3», но она носит совершенно гипотетический характер, и её наличие у современных «потомков» Чингисхана (тоже предполагаемых, кстати, поскольку подавляющее большинство его реальных биологических прямых потомков было уничтожено в процессе междоусобных войн) вовсе не исключает возможности несколько иного генного набора у других, т.е. не центрально-монгольских и китайских, тоже гипотетических, ветвей виртуальных «потомков», на основе генов которых и был вычислен пресловутый «ген Чингисхана С3». При этом следует обратить особое внимание на генетические исследования потомков старшего сына Чингисхана Джучи и хазарейцев, у которых довольно часто встречается наша «кельтская» генная группа (т.е. саяно-алтайская и башкирская).

        Хазарейцы, как народ, произошли от элитных гвардейских монгольских отрядов, которые остались в Афганистане после походов на запад.
        Сами хазарейцы называют себя «хазара», от персидского «тысяча». Хазарейцы – ираноязычные шииты монгольского происхождения, населяющие центральный Афганистан (по различным данным 8–10 процентов от общей численности населения страны, что примерно равно от 2,8 до 3,8 миллиона). Причем, 32 процента обследованных хазарейцев имеет наш набор генов, но с другой стороны – имеется высокий процент совпадения с генами потомков Чингисхана.

        У нас есть веские основания сомневаться в 100-процентной правильности определения «гена Чингисхана» как «С3», и есть все основания считать нашу генную группу, столь же достойной для определения генома реальных потомков Чингисхана (точнее, «старших сородичей»), причем, по линии его старшего сына Джучи и арийской праматери Алан-Хо. Тем более, что, согласно традиционной монгольской генеалогии, родословная «золотого рода» Чингисхана вплоть до его прадеда Кабул-Хана отсчитывалась именно от Алан-Хо, т.е. через женскую линию родства.

        А мужская линия родства вообще является мифической, или, точнее, фиктивной, поскольку мужские предки Чингисхана родились из «чистых чресел» Алан-Хо после смерти законного мужа Добу-Мергена, который считается одновременно предком и монголов, и урянхайцев, от ее незаконного мужа (сожителя) некоего Магалиг Баягудайя (кстати, тоже урянхайца).

        Но существует версия, что старший сын Чингисхана Джучи не был его родным сыном. Имя Джучи переводится как «гость». Согласно «Сокровенному сказанию монголов», Джучи на самом деле был сыном Чилгера, который похитил и держал наложницей в плену Бортэ, любимую жену Чингисхана, целых полгода, пока её не отбил обратно Темучин (первое имя Чингисхана).

        В соответствии с легендой, сыновья Чингисхана неоднократно выражали сомнения относительно их родства с Джучи, но сам Чингисхан называл Джучи родным сыном. Тем не менее, из-за сомнений о происхождении Джучи Чингисхан был вынужден назначить наследником своего третьего сына, Угэдэя. Ни один джучид так и не стал каганом Монгольской империи, а современная монгольская историография утверждает, что Джучи вообще никогда не был монгольским ханом.

        При определении потомков Чингисхана необходимо учитывать, что джучиды нередко брали себе жен из ильханской династии Персии, родоначальником которой считается Хулагу-Хан. Следовательно, у многих джучидов также присутствуют и гены Чингиса по материнской линии. Поэтому в любом случае, для нас, саяно-алтайских сородичей Чингисхана, Джучи-Хан является нашим кровным ханом, вполне легитимным наследником Чингисхана и родоначальником Золотой Орды.

        Тем более, в нашей генеалогической традиции любой незаконнорожденный сурас считается не менее законным преемником и наследником своего отца, если тот официально назвал его своим сыном. Поэтому мы вправе считать себя и наследниками Джучи, и сородичами Чингисхана одновременно.

        По материалам газеты "Тувинская правда".

        Вообщето сам Чингизхан тоже считался не Моҕолом, возможно в нем была кровь его врагов меркитов, впрочем все они были татарами, а значит предки были одинаковые, судя по карте генома Чингизхана-это САХА.

        0
        • Оidоv
          3 ноября 2012  

          Правильно Гыы Гыы ! Не нужно быть трусом , может он правда предок саха .

          Исторические сведения , на это указывают . В нём много Урянхайских и Ураанхай кровей . Ведь всё на поверхности , почему хотя бы хакасы не пробовали доказать ? У меня вызвало подозрение , его " симпатии " к Урянхайским племенам и совпадения , названий мест в Якутии . Хотя , не ученый , а значит говорю о " шкуре не убитого медведя " . Ну хоть грамотные люди , обратили внимание , а то череп и неолит - как доказательство , против " южан " - не учей и ученые слова .

          0
      • offen
        3 ноября 2012  

        из книги А.А.Акимова "Тайна предков курыкан"

        Оказывается в старину в Олекминском, Верхневилюйском, Сунтарском улусах проживали воинственные племена "Мэйи-мэркит". Со временем с годами слово "мэрки" начало забывться, но вместо него сохранилось слово "мэ прибавкой буквы "К". Теперь слово "Мэйик" твердо превратилось в название поселков, где жили воинственные племена "Мэйи-мэркит" так и сохраняясь до наших дней.

        0
        • гыгы999
          4 ноября 2012  

          Уважаемый Оффен, я тоже давно заметил название якутских деревень,

          очень часто напоминают названия исторических племен или имена их вождей. Причем благодаря нашему форуму прихожу к выводу, что расселялись они согласно старинному регламенту и субординации, по крайней мере в центральной Якутии - правое крыло, центр, левое крыло.
          Про "Мэйи-мэркит" устное упоминание было или где-то можно найти в архивах мэРки?
          Насчет спора про автохтоннство и "южан" я уже говорил свое мнение, моя версия "Исторический круг" нашего народа САХА. Вышли оттуда приручив дикую лошадь и вернулись через много веков обратно.
          Сегодня посмотрел новости, там нашли первый городишко на территории Европы, население в 300 человек занималось солеварением и было это в середине V в. до н.э. Как раз в это время наши предки кочевники САКИ уже вовсю воевали с персидским царем Дарием I и имели свое кочевое государство на берегах Черного моря.

          0
          • offen
            4 ноября 2012  

            не так давно появился форум Исторический, даже по нему можно делать исследования ))

            из кому за:
            - админу, модератору:господа, удалите в отдельный форум все историко-этнографические изыски, плиzzz!Автор: gaspro () 12.09.2003 (11:27)    
            и всякие социо-сексопато-логи пусть для себя матерьял собирают в своих специальных форумах!

            - Форум "исторический" ввести бы, а ? Вот только модератор там нужен будет "железный" и на руку скор да тяжёл :)) - DVA12.09.2003 (11:37)

            - gaspro - off [это мой ранний ник-а теперь offen] 12.09.2003 (12:15) ()    
            правильно! и обсуждение качества презервативов и женских прокладок в спец.форумы )))))

            прошло немало времени и так появилось множество форумов, что теряешься где можно бы пофлудить..:-)))))

            0
          • offen
            4 ноября 2012  

            Про "Мэйи-мэркит" только в республиканских изданиях

            из записок Г.В.Ксенофонтова: процесс включения различных субэтнических групп в состав якутского народа.
            I. первые поселенцы - улусы Сев.вилюя. (часть их урянхайцы).
            II. за ними Омолдонцы -Жарханцы и Бордонцы (и значительная часть Амгинских якутов). Северные хунны.
            III. за ними группа Таттинцев, Баягантайские, Намцы.Борогонцы (акающие). Эпоха жужан (протоуйгуры и остатки сев.хуннов).
            IV. за ними группа Мегино-Мальжегаров. Гаогюйцы (ранние уйгуры).
            V. за ними Кангаласцы. Поздние уйгуры. (окающие).

            0
            • Оido
              4 ноября 2012  

              Версия : Думаю всё намного проще . Урянхай и Ураанхай , а также Уранхус калмыков .

              Это осколки трех больших конгломератов племен . Последнее время 8ой -10ый век , занимали пространство , от Забайкалья до Алтая . С усилением , многочисленных племен монголов и татар . Род Борджигинов , переместились в долину Витима , или раньше ? К этому времени , мобилизованные воины чорос , угулят баатут и другие , полегли , в большинстве своем , на полях " объединения " , ещё во время ЧХана . Оставалось лишь племя Удачи , которые стерегли погост Чингизидов . Влияние Урянхай и Ураанхай ослабло - после смерти ЧХана , не без помощи " урянхайца " Даяна , их ждала ассимиляция . продолжение следует .

              0
              • Оido
                4 ноября 2012  

                Остатки царского рода БОРДДЬИГЫН , ушли в северные земли .

                Без них , беспредел , грабежи , со стороны соседей , на остатки родов , увеличились . К тому , же добавилась экспансия маньжур - Китая - (тысячилетние враги Ураанхай ). Поэтому , другие рода Ураанхай саха , тоже потянулись на север , в поисках лучшей жизни . К началу 17го века , их вероятно , насчитывалось 30ать - 40ок тысяч . К приходу казаков , они стали активно расселяться . Думаю казаки , стали символом - центром ВЛАСТИ и ЗАКОНА , для простых людей . Это было время переходного периода , после кратковременной деградации народа . Это не то , что доказывают автохтонты и державники . Но о великом ЧХане и так ясно . Его отец коренной монгол , пробовал объединить многочисленные (больше 70ти родов и племен ) рода и племена монголов . Это удалось , его сыну , Темучену , с помощью родственных родов и племен Урянхай и Ураанхай саха , по научению матери Одьулуун . О происхождении Ураанхай саха , написанно в Олонхо - Платона Ойунского - сына Татты . Наверное Ураанхай саха , пришли с восточного Тибета , вместе с племенем ЧХана - это из летописи Рашида и Олонхо . Не зависимо , что решат ученые и политики , мнение останется . Главное не физический облик Ураанхай саха , оно может изменится . Главное вернуть гордое имя Ураанхай , которое забрали - лишили Чингизиды и КYЛYКи .

                0
                • Могул
                  4 ноября 2012  

                  Oido

                  Все правильно! Забыли, кто такие были Сүбэтэй, ДьаҺалыма,- самые успешные полководцы ЧХ. Сүбэтэй в одно время даже нагайкой утихомирил чингизидов чтоб поставить Батыя каганом! Вот и мстят.
                  В одно время я играл по переписке с одним тувинцем. И он пишет, что они мол есть УРАНХАЙЦЫ, а уранхай по монгольски есть ОБОРВАНЦЫ! Вот до чего довели народ! Поэтому основное ядро империи ЧХ, то есть то ядро, благодаря чему он начал свое восхождение, подались на север, то есть сюда, в Якутию. Ведь их было всего то 15 тысяч, которые подчинили 110 тысяч и присоединили их ЧХ. И они долго сопровождали ЧХ обеспечивая монолит империи. И если бы Бордонцы и другие Уранхай Саха не ушли бы через Витим и Вилюй, то их обязательно перебили бы, как орава собак, нападая на самого сильного! И их было не менее 100 тысяч, поскольку как посчитал Р. К. Маак в 18 веке по Вилюйскому округу жили уже ровно 51458 якутов.

                  0
                  • Оidоv
                    4 ноября 2012  

                    Опять не пропускают - свидетельство Марко Поло

                    Марко Поло - не заинтересованный свидетель истории .

                    0
                    • Оidоv
                      4 ноября 2012  

                      Модераторам - кулюк это чин , у монголов , навроде наших тойонов .

                      Повода банить , по этому поводу смешно .

                      0
                      • Оidоv
                        4 ноября 2012  

                        Версия :- Кулюки , затаили злобу на урянхай и ураанхай , со времен ЧХана .

                        Этому свидетельство Марко Поло : - " Только тойоны урянхай , имели право пить кумыс , из табуна , белых кобылиц , ЧХана . " Добавлю , Марко Поло , не заинтересованное лицо в истории - как косвенный " свидетель " . Справка КYЛYК - ТЕНЬ , с перевода саха . В истории они считались тенями ЧХана , так и осталось .

                        0
                  • Оidоv
                    5 ноября 2012  

                    Их было намного больше , вместе с племенами татар - больше миллиона .

                    Мнение : В степи , племя кочевников могло противостоять другому племени - это примерно 1000 людей . Родов и племен 75ять - 76есть - это по Рашиду и Олонхо ? Плюс другие племена татар , киданей .

                    0
      • гыгы999
        4 ноября 2012  

        Могул ты прав.

        Цитата:
        Кутлуг II 795 — 805 кит. упр. 懷信可汗, пиньинь:huaixinkehan, палл.:Хуайсинькэхань кит. упр. 骨咄禄,пиньинь: guduolu,палл.: Гудулу кит. упр. 爱腾里逻羽录没密施合禄胡毗伽可汗, пиньинь:aitengliluoyulumeimishiheluhupigakehan, палл.:Айтэнлилоюйлумеймишихэлехупигакэхань Ay Tängridä Ülüg Bulmıš Alp Qutluğ Uluğ Bilgä Qağan
        Кюлюг-Бильге-хан 805 — 808 кит. упр. 滕里可汗, пиньинь:tenglikehan, палл.: Тэнликэхань кит. упр. 俱錄毗伽,пиньинь: julupiga, палл.:Цзюйлу Пига Тэнлиехэцзюйлупигакэхань(滕裏野合俱錄毗伽可汗) Ay Tängridä Qut Bulmıš Külüg Bilgä Qağan
        Бо-и-хан 808 — 821 кит. упр. 保義可汗, пиньинь:baoyikehan, палл.: Баоикэхань кит. упр. 李孝誠,пиньинь: li xiao cheng,палл.: Ли Сяочен кит. упр. 爱登里罗汩密施合毗伽可汗, пиньинь:aidengliluogumishihepigakehan, палл.:Айденлилогумишихэпигакэхань Ay Tängri-dä Qut Bulmıš Alp Bilgä Qağan
        Чин-дэ-хан 821 — 824 кит. упр. 崇德可汗, пиньинь:chongdekehan, палл.:Чундэкэхань неизвестно кит. упр. 登啰羽錄沒蜜施句主毗伽崇德可汗, пиньинь:dengluoyumeimishijuzhupigachongdekehan, палл.:Дэнлоюмеймишицзючжупигачундэкэхань Kün Tängridä Ülüg Bulmıš Alp Küčlüg Bilgä Qağan
        Чжаоли-хан 824 — 832 кит. упр. 昭禮可汗, пиньинь:zhaolikehan, палл.:Чжаоликэхань Хэса Телей (曷薩特勒) кит. упр. 愛登裏羅汨沒密施合毗伽昭禮可, пиньинь:aidengliluomimeimishihepigazhaolikehan, палл.:Айдэнлиломимэймишихэпига Чжаоли-кэхань Ay Tängridä Qut Bulmıš Alp Bilgä Qağan
        Кюлюг-бег-хан 832 — 839 кит. упр. 彰信可汗, пиньинь:zhangxinkehan, палл.: Чжан Синь-кэхань Ху Телэй (胡特勒) кит. упр. 為愛登裏羅汨沒蜜施合句錄毗伽彰信可汗, пиньинь:aidengliluomimeimishihejulupigazhangxinkehan, палл.:Айдэнлиломимэймишихэцзюлупига Чжан Синь-кэхань Ay Tängridä Qut Bulmıš Alp Külüg Bilgä Qağan
        Междуцарствие 839 — 840 нет нет нет нет
        Хэса Тэлей (jp:コウソウ特勤)[10]
        Уге-хан 840 — 846 кит. упр. 乌介可汗, пиньинь:wujiekehan, палл.: Узце-кэхань кит. упр. 乌介, пиньинь:wujie, палл.: Узце нет Öge
        Распавшийся каганат 847 — ок. 856 год

        Начиная с Кутлуга II (795-805гг) Уйгурские Каганы стали приписывать к своему титулу [b]Ay Tängridä Ülüg Bulmıš Alp Qutluğ Uluğ Bilgä Qağan [/b]божественное звание АЙЫЫ ТАҕАРА, то есть эти УЙГУРЫ были нашими предками и верили в наше Верховное божество ТАҥАРА.
        В с 839 началось "Смутное время" Междуцарствие, последний каган был Узце-кэхань (840-846) или Öge, сахалы -өҕүй=хан
        непроизвольно тужиться, напрасно напрягавшийся хан, так и не смог восстановить это государство.
        ВРЕМЯ КАК Я ГОВОРИЛ ВВЕРХУ, СОВПАЛО С ЭКСПАНСИЕЙ ИСЛАМСКОЙ ВЕРЫ, Т.Е. НАЧАЛО ИХ И КОНЕЦ ТЕНГРИАНСТВА - КАК ГОСУДАРСТВЕННОЙ ВЕРЫ 846 ГОД Н.Э.
        НАЧАЛО РАСПАДА НАШИХ ПРЕДКОВ.
        В 847 году последний каган Энянь дэлэ-хан взял с собой жену, сына и 9 воинов, и уехал на запад. Больше его не видели. Знатные уйгуры, укрывавшиеся с ним у татар, стали татарскими пленниками, но вскоре 70 000 кыргызов хана Або заставили их отдать всех пленных кыргызам.
        Потеряв лидера, уйгуры «скрывались по горам и лесам» от кыргызов.

        0
        • ナイキ air
          16 сентября 2013  

          ナイキ air

          Does your site have a contact page? I'm having problems locating it but, I'd like to send you an e-mail. I've got some creative ideas for your blog you might be interested in hearing. Either way, great blog and I look forward to seeing it improve over time.
          <a href="http://www.nikejashoes.com/" >ナイキ air</a>

          0
      • гыгы999
        4 ноября 2012  

        Очень часто вижу звание БИЛГЭ ХАН.

        С як. словаря
        Билгэ
        узнавание, распознавание по приметам (напр. погоды); предугадывание;
        Тот кто много знает, предугадывает-МУДРЫЙ.
        У русских был князь Ярослав Мудрый, у наших предков Тюркских и Уйгурских Каганов Билгэ Хан.
        Например:

        Цитата:
        Бильге-хан Богю 716-734 Богю кит. упр. 毗伽可汗, пиньинь:pijiakehan — Пицзякэхань кит. упр. 阿史那默棘連, пиньинь:ashinamojilian — Ашина Моцзилянь нет Бильге-хан — «Мудрый хан; герой»

        Билгэ-хан Бөҕө. даже перевод правильный здесь "Мудрый хан;герой-непоколебимый человек".
        Бөҕө
        I. крепкий; бөҕө таҥас крепкая ткань; бөҕө киһи а) сильный человек; б) стойкий, непоколебимый человек; бөҕө эйэ нерушимый мир; и дадут, я возьму с удовольствием; барсан бөҕө я охотно пойду с вами.

        0
        • nike
          19 сентября 2013  

          http://www.nikejashoes.com/

          Does your site have a contact page? I'm having trouble locating it but, I'd like to send you an e-mail. I've got some suggestions for your blog you might be interested in hearing. Either way, great site and I look forward to seeing it improve over time.

          0
      • гыгы999
        4 ноября 2012  

        Оффен вот нашел по Ксенофонтову одно племя:

        Цитата:
        III. за ними группа Таттинцев, Баягантайские, Намцы.Борогонцы (акающие). Эпоха жужан (протоуйгуры и остатки сев.хуннов).

        Цитата:
        8. Баегу-Байырку (拔野古, 拔野固 , 拔曳固) Жили севернее Гоби, восточнее пугу, но западнее мохэ. 60 000 юрт при 10 000 войска. В их стране прекрасные травы, отличные лошади и есть производство железа. В их землях протекает река Кангань (康幹河) в которую кидали на 3 года сосны и доставали их древесину, которая называлась канганьский камень (康幹石) (ср. морёный дуб). Баегу любят охоту и умеют охотятится на оленей на льду озёр, гоняясь за ними на лыжах. Обычаи как у теле, но наречия несколько различаются. В 629 присылали, вместе с другими родами, послов в Китай. В 647 старейшина Сылифа Цюйлиши(俟利發屈利失) подчинился данастии [[Тан (династия)]. Земли были присоединины к дудуфату (都督府, примерно: генерал-губернаторство) Юлин (幽陵), старейшина получил чин ювуйвэй да цзанцзюнь (右武衛 大將軍 , главнокомандующий правой воинственной гвардией, 3-й основной ранг). В 656—660 они бунтовали вместе с другими племенами. Их подавил Чжен Жэнтай (鄭仁泰) главнокомандующий левой воинственной гвардии (左武衛大將軍), старейшина был убит. В 742 пожелали восстановить подданство Тан.

        0
      • гыгы999
        4 ноября 2012  

        Кстати нынешние Уйгуры никак не являются потомками Уйгурских каганатов.

        Л.Н. ГУМИЛЕВ ТАК И НАПИСАЛ:
        В 9 веке жители Турфана (Турфанская впадина на юге Тянь-Шаня), Карашара и Кучи стали называть себя уйгурами.

        Страна Уйгурия, состоящая из оазисов разбросанных в пустыне, осталась без единого названия, Китайцы назвали её «Западный край» и концом её «луковые горы» (Памир и Алтай), употреблялись так же названия: Кашгария, Восточный Туркестан…

        Богатство этой страны базировалось главным образом на выгодном географическом положении: через нее шли два караванных пути: один севернее, другой южнее Тянь-Шаня. По этим путям китайский шелк тек в Прованс, а предметы роскоши Франции и Византии - в Китай.

        В оазисах караванщики отдыхали от тяжелых переходов через пустыню и откармливали своих верблюдов и лошадей. В связи с этим у местных женщин весьма развилась «первая древнейшая профессия», а мужья разрешали женам эти заработки, часть из которых шла им в карман. И уйгурки так к этому делу привыкли, что даже во время союза с монголами, жители просили монгольского хана не запрещать их женам развлекать путешественников.

        Этот обычай, правильно сказать – элемент этнического стереотипа поведения, оказался более стойким, нежели язык, религия, политическое устройство и самосознание. Стереотип складывался, как способ приспособления этноса к географической среде.

        0
      • offen
        5 ноября 2012  

        все ищут прародину тюрков

        http://turan.info/forum/showthread.php?t=6562&page=3

        Цитата:
        Распад древнетюркской общности:

        1. протобулгары (протогунны, проточуваши) - 4-3 тыс. до н.э - путь через Кавказ на север : Закавказье > Северное Причерноморье > Северное Поволжье.
        2. протоуйгуры (лобноро-таримцы), протоякуты, протохакассы, прототувинцы - 3-2 тыс. до. н.э. -путь по Евразийской степи на восток: Волга>Урал> Енисей>Таримская впадина.
        3. протохунны( протокыпчаки) - 2 тыс. до. н.э.- путь по Евразийской степи на юго- восток: Волга>Урал > Мангышлак> Алтай> Монголия-Ордос.
        4. протоогузы, юечжы (пазырыкцы), протоусуни, протокарлуки. Середина первой половины первого тысячелетия до н.э. путь на восток: Закавказье > Памир > Монголия > Алтай.


        Уважаемые форумчане,
        Как я ранее сообщал, я завершил работу над книгой «Историческая прародина тюрков. От Арана до Алтая». Готов компьютерный вариант книги. Ищу спонсора для печати книги.
        В книге около 200 цветных фотографий и свыше 100 карт. На сайте форума такой материал разместить невозможно. Желающие ознакомиться с некоторыми отрывками из моей книги, могут их скачать отсюда http://ifolder.ru/24855453
        По –прежнему, с нетерпеньем жду Ваших мнений.
        С уважением,
        Гумбатов Гахраман.

        0
      • гыгы999
        5 ноября 2012  

        Молодец Гумбатов Гахраман желаю удачи!

        Моя версия прапрапрапредками всех тюркских народов являются САКИ. Я только начал и нахожусь вначале пути, а сколько уже раскопал).

        0
      • гыгы999
        5 ноября 2012  

        Табалдиев Древние памятники Тянь-Шаня. Кому интересно посмотрите.

        http://www.docme.ru/doc/92352/tabaldiev-drevnie-pamyatniki-tyan._-shanya

        0
        • Могул
          5 ноября 2012  

          гыгы999

          Кыайан аЬыллыбата.
          shanya - шаньюй? Ити тыл этимологиятын билиэхпин ба5арар этим. Ким диэн тыл эбитэ буолла?

          0
          • Никон
            5 ноября 2012  

            Туох уустуктааҕый доо...

            Щаньюй = китайская транскрипция слова Ашина, ашима.
            По Сах сакралу Аһыма = a homo.
            Первопредок человека: Аһыҥастаах Аһыма = Ашинное ашима =
            Клыкастый волчий вид на которого был поселен дух человека
            на земле этой. Перволюд.
            Из них были цари, каганы и только из них.
            Род царей и господ.
            В китае тоже господствовали Ашины.
            Во все времена.
            Порабощенный китай это знает.
            А наши своего первопредка даже незнают.

            0
            • Могул
              5 ноября 2012  

              Никон

              Этэр эттэ5инэ итинник тахсыан сөп курдук! Но, как я понял, это же вроде ПРЕЗИДЕНТА было, то есть выборная должность тюрков!

              0
              • Никон
                5 ноября 2012  

                Тебе бы подучиться...

                Или доучиться...
                Каганов и царей раньше избирали.
                Чингис-хана тоже.
                А монархия изобретение позднее.
                От жажды власти зародилось.
                Бог ты мой... с кем приходится иметь дело....

                0
                • Могул
                  5 ноября 2012  

                  Никон

                  Я спросил. Ты ответил. Пращу не рапространяться, негодник!

                  0
                • гыгы999
                  5 ноября 2012  

                  Могул у всех тюрков и монгологоворящих есть легенда происхождения их народов от волка.

                  Тут Никон на 100% прав.

                  Цитата:
                  Щаньюй = китайская транскрипция слова Ашина, ашима.
                  По Сах сакралу Аһыма = a homo.
                  Первопредок человека: Аһыҥастаах Аһыма = Ашинное ашима =
                  Клыкастый волчий вид на которого был поселен дух человека
                  на земле этой. Перволюд.
                  Из них были цари, каганы и только из них.
                  Род царей и господ.
                  В китае тоже господствовали Ашины.

                  Аһыы
                  II 1) остриё, жало; лезвие; иннэ аһыыта остриё иглы; сүгэ аһыыта острый угол лезвия топора; 2) клык; бөрө аһыыта клык волка, волчий клык.
                  Насчет Монархии это не позднее изобретение, узурпирование власти было всегда.
                  Монархия (от греч. monarchía — единовластие, единодержавие), в эксплуататорских государствах форма правления, при которой верховная государственная власть формально (полностью или частично) сосредоточена в руках единоличного главы государства — монарха. Монархическая форма правления существовала в рабовладельческом и феодальном обществе, она сохранилась и в ряде буржуазных государств.
                  ПРО СОВРЕМЕННОСТЬ Я СКРОМНО ПРОМОЛЧУ)))

                  0
      • гыгы999
        5 ноября 2012  

        Заинтересовала этимология имени КУТЛУГ.

        Впоследствии это имя было как звание у исторической личности сына Тимура I.

        Скрытый текст
        Хан Тимур-Кутлуг (годы жизни: 1370 – 1399) был сыном хана Тимура I. На исторической сцене он впервые появляется при дворе Тамерлана в качестве царевича (оглана), его активная деятельность началась в свите Тамерлана лишь с началом военных действий против Токтамыша.
        В Орде повторилась ситуация с Ногаем и Мамаем. Эмир Едигей к началу XV века был полновластным хозяином в Орде и по своему усмотрению возводил на трон того или иного представителя Джучидской династии. Хан Тимур-Кутлуг, подстрекаемый эмиром Едигеем, воспользовался разгромом Токтамыша и начал энергичную политику для захвата власти в Золотой Орде.
        Стоя во главе золотоордынского войска, Тимур-Кутлуг начал сражение на берегу р. Ворскла с литовскими военными отрядами князя Витовта и отрядом хана Токтамыша. Битва окончилась поражением Токтамыша – войска бежали, бросив огромный обоз победителям. Татары бросились по следам и опустошили киевские и литовские земли, взяли откуп с Киева.
        Но и победитель – хан Тимур-Кутлуг недолго почивал на лаврах после этого грандиозного сражения. Ещё очень молодой хан, видимо, стал проявлять стремление не только называться ханом, но и править своим ханством. Поэтому темник Едигей организовал государственный переворот, убив Тимур-Кутлуга и возведя в ханское достоинство его младшего брата Шадибека.
        В годы правления Тимур-Кутлуга монеты чеканились в Орде и Крыму. Часть крымских дирхемов Тимур-Кутлуга чеканилась с использованием старых штемпелей Токтамыша 791 и 796 Г.Х.

        Из вивкипедии
        Скрытый текст
        Тиму́р Кутлу́г (туркм. Kutlug Timur — «святой Тимур») — хан Золотой Орды в 1395—1399, племянник Урус-хана. После поражения Тохтамыша, был посажен на Золотоордынский престол могущественным темником Едигеем, который был фактическим правителем Орды. Тохтамыш не терял надежды на восстановление своей власти в Золотой Орде и для этого заключил союз с князем Витовтом. В 1399 году произошла грандиозная битва на реке Ворскле. Войска Тимур Кутлуга под командованием Едигея наголову[источник не указан 316 дней] разбили объединённые войска Витовта и Тохтамыша, но победившая сторона ничего не получила от своей победы. Тохтамыш бежал в Сибирь, где у него было ещё немало сторонников. Там он захватил власть в Тюменском юрте (1399). Победитель — хан Тимур-Кутлуг недолго почивал на лаврах славы после этого грандиозного сражения. Ещё очень молодой хан, видимо, стал проявлять стремление не только называться ханом, но и править своим ханством. Поэтому темник Едигей организовал государственный переворот, убив Тимур-Кутлуга и возведя в ханское достоинство его младшего брата Шадибека.

        Здесь КУТЛУГ-СВЯЩЕННЫЙ.
        в як. языке есть слово
        хатылаа=
        повторять; ааспыты хатылаа = повторить пройденное; эппити хатылаа = повторить сказанное; ср. төхтүрүй =.
        В бывшем Ботуруском улусе(Чурапчинском)есть наслег ХАТЫЛЫК.
        КУТЛУГ-ХАН ПЫТАВШИЙСЯ ПОВТОРИТЬ ПРОЙДЕННЫЙ ЕГО ПРЕДКАМИ ПУТЬ, ЗАВОЕВАТЬ МИР ОТ МОРЯ ДО МОРЯ. ВПОСЛЕДСТВИИ ЭТО ДРЕВНЕЕ ИМЯ У ОМУСУЛЬМАНЕННЫХ ТЮРКОВ СТАЛО СВЯЩЕННЫМ.

        0
        • Никон
          5 ноября 2012  

          че то вы ребя совсем того...

          Кутулук = Кут(дух)+улуу(величие)+ук(совать, поселить, всунуть) =
          Имеющий величие духа буквально = Великодушный по современному если перевести на русский. Многие цари так звались...
          Слыть в народе царем добрым, великодушным считалось высшим смыслом для правителя. Все этого добивались. И в именах тоже.
          Улукбек = Улу(вели)+ук(имеющий, всунутый)+бигэ(прочняк) =
          Напрочь всунутое Величие буквальный перевод = Прочнославный
          в переводе на совр. русский.

          0
      • гыгы999
        5 ноября 2012  

        Этимология КАГАН, тоже вызывает сомнение.

        Каган
        КАГАН. Заимств. в др.-рус. эпоху из тюрк. яз., где оно (kagan, kaγan) — из китайск. ke̯, "великий" и kuan "правитель".
        Есть якутское слово
        Кыаҕыр=
        становиться мощным, сильным; крепнуть;
        Кыаҕырт=
        побуд. от кыаҕыр = придавать силу, мощь; укреплять.
        КЫАҕЫН ЫЛБЫТ ТОЙОН (Буквально- СТАВШИЙ МОЩНЫМ НАЧАЛЬНИК).
        КАГАН ПРОИСХОДИТ ОТ ЯЗЫКА САХА- КЫАХ.
        кыах
        1) СПОСОБНОСТИ;возможности;
        кыахтаах
        1) имеющий какие-л. возможности, с... возможностями; 2) имеющий какую-л. возможность;3) обладающий какими-л. способностями, способный.

        кыахтан=
        1) становиться мощным; 2) получать возможность (делать что-л.);
        КЫАҕАН-КАГАН-СТАВШИЙ ОКРЕПШИМ, СИЛЬНЫМ, МОЩНЫМ!
        ЭТО СЛОВО И ТИТУЛ НАШИХ ПРЕДКОВ - КОЧЕВНИКОВ САКА!

        0
        • Никон
          5 ноября 2012  

          Ну ты парень даешь... Недоумок че ли...

          Кыа-хаан = каган = именем краснокрови в переводе на русский.
          Это когда голубая кровь менялась на краснокровь
          Хааны правили. При смене крови. Над хаанами стояли кыа-хааны
          = хахан = каган.
          Изучи историю смены крови.
          Че вы такие недоучки то такие.
          Сельмой класс пройди еще раз.

          0
          • Атас
            5 ноября 2012  

            айыбыын, иэдээн дии...

            бу туохха-туохха түбэстим, до5оттоор, бу туох буоллугут! Тылы итинник ырытыллар үһү дуо? Бу хантан кэлбит уонна ким боломуочуйалаабыт "учууталлара" үөрэтэллэрий? "Недоучки" диэбит буола-буолалар! Сааттаах дьыала!
            До5оттор, тылгытын харыстааҥ, күлүүгэ-элэккэ кубулутумаҥ.

            0
          • гыгы999
            5 ноября 2012  

            Моя версия разве противоречит твоему?

            [quote]Кыа-хаан = каган = именем краснокрови в переводе на русский.
            Это когда голубая кровь менялась на краснокровь
            Хааны правили. При смене крови. Над хаанами стояли кыа-хааны
            = хахан = каган.
            ХААНЫН КЫАҕЫРАР.
            ХААН -АРТЕРИАЛЬНАЯ КРОВЬ.Артериальная система
            Артерии, которые почти не содержат гладких мышц, но имеют мощную эластическую оболочку, выполняют главным образом «буферную» роль, сглаживая перепады давлений между систолой и диастолой.
            КЫА ХААН-ВЕНОЗНАЯ.Венозная система
            От органов кровь возвращается через посткапилляры в венулы и вены в правое предсердие по верхней и нижней полым венам, а также по коронарным венам.

            0
            • Никон
              5 ноября 2012  

              Ладно...

              Нам с тобой не по пути...
              Возиться с тобой..
              оставайся при себе.

              0
      • гыгы999
        5 ноября 2012  

        По Сакралу я конечно ниже тебя уровнем)), поэтому ты и нужен мне.

        0
      • гыгы999
        5 ноября 2012  

        Перейдем ко 2 разделу повествования Рашида, про Огузов анм неинтересно.

        Скрытый текст
        РАЗДЕЛ ВТОРОЙ

        |А 12б, S 27| ОТНОСИТЕЛЬНО ТЕХ ТЮРКСКИХ ПЛЕМЕН 309, КОТОРЫХ В НАСТОЯЩЕЕ ВРЕМЯ НАЗЫВАЮТ МОНГОЛАМИ, НО В ДРЕВНИЕ ВРЕМЕНА КАЖДОЕ ИЗ ЭТИХ ПЛЕМЕН В ОТДЕЛЬНОСТИ НОСИЛО [СВОЕ] ОСОБОЕ ПРОЗВИЩЕ И ИМЯ; КАЖДОЕ ИМЕЛО [СВОЕГО] НАЧАЛЬНИКА И ЭМИРА; ОТ КАЖДОГО ПРОИЗОШЛИ [РОДОВЫЕ] ВЕТВИ И ПЛЕМЕНА, ВРОДЕ НАРОДОВ: ДЖАЛАИРЫ, ОЙРАТЫ, ТАТАРЫ И ДРУГИЕ, КАК ЭТО БУДЕТ ПОДРОБНО ПОКАЗАНО В ЭТОЙ ГЛАВЕ

        Их обиталища [йурт] и становища [макам] были в определенных местах. Их внешний облик и язык похожи на внешность и язык монголов, потому что в то [древнее] время монголы были народом, принадлежащим к тюркским племенам; в настоящее же время вследствие их счастья, могущества и величия все другие племена называются этим их специальным именем.

        Племя [b]джалаир[/b],
        Скрытый текст
        их ветви и некоторые повествов